KIAA0706

Product ID	ORK01112
Accession No	AB014606
Description	kinesin family member 1C
Clone name	pj01355
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4218 bp) Predicted protein sequence (1123 aa)
HaloTag ORF Clone	FHC01112
Flexi ORF Clone	FXC01112
Source	Human brain (hippocampus)
Rouge ID	mKIAA0706 by Kazusa Mouse cDNA Project
Note	We replaced hg04286, former representative clones for KIAA0706 with pj01355. (2004/1/10)

Length: 4218 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	553 bp
Genome contig ID	gi51511734f_4741971
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GATGTGGGCCCTTTAATAAAGGATAGCAAACAGGG
Flanking genome sequence (126752 - 126801)	----+--------+--------+--------+--------+----* AGCTTGTGGCCTGTTTGTTTTGGGTTTTCATGGAGGTGTAGGTTATATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	4841971	4868721	23	99.7	Perfect prediction

Length: 1123 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O43896	100.0	Kinesin-like pr...	Homo sapiens
XP_001117788	98.5	similar to kine...	Macaca mulatta
AAC52117	99.3	kinesin-like mo...	Homo sapiens
XP_511296	99.0	kinesin family ...	Pan troglodytes
XP_001502938	96.2	kinesin family ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040881	1.3e-55	62.2	KIAA1448
AB011163	2.3e-54	71.3	KIAA0591
AB014539	2.4e-37	46.7	KIAA0639
AB046810	8.8e-32	42.5	KIAA1590
D26361	3.1e-30	42.1	KIAA0042

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	108	129	PR00380	Kinesin
	IPR001752	228	245	PR00380	Kinesin
	IPR001752	263	281	PR00380	Kinesin
	IPR001752	318	339	PR00380	Kinesin
HMMPfam	IPR001752	31	369	PF00225	Kinesin
HMMPfam	IPR000253	543	610	PF00498	Forkhead-associated
HMMSmart	IPR001752	23	376	SM00129	Kinesin
ProfileScan	IPR001752	22	293	PS50067	Kinesin
ScanRegExp	IPR001752	262	273	PS00411	Kinesin