HUGE

Gene/Protein Characteristic Table for KIAA0055

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01051
Accession No. :	D29956
Description :	Ubiquitin carboxyl-terminal hydrolase 8.
HUGO Gene Name :	ubiquitin specific peptidase 8 pseudogene (USP8P)
Clone Name :	ha01049 [Vector Info]
Flexi ORF Clone :	pF1KA0055
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4359 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 685 bp

Genome contig ID gi51511731f_48403892
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
ATTTACAGCTACATTAAAATCTTAATGAGAAAAAT
Flanking genome sequence
(175373 - 175422)
----+----*----+----*----+----*----+----*----+----*
AATTTATAACCCTGTGGGTGTTCTGTCTTTAATATTGTATTATCAAATAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 48503892 48579263 20 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1120 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P40818	100.0	Ubiquitin carbo...	Homo sapiens
BAF85089	99.8	unnamed protein...	Homo sapiens
CAD97662	99.7	hypothetical pr...	Homo sapiens
XP_001168710	99.6	ubiquitin speci...	Pan troglodytes
XP_001114466	98.4	ubiquitin speci...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011101	1.7e-13	41.8	KIAA0529
AB020698	1.7e-12	38.1	KIAA0891
AB029020	1.4e-06	32.7	KIAA1097
AB023220	4.1e-06	29.8	KIAA1003
AB028986	1.5e-05	29.9	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR015063 8 115 PF08969 Domain of unknown function DUF1873

IPR001763 186 309 PF00581 Rhodanese-like

IPR001394 776 1108 PF00443 Peptidase C19

ProfileScan IPR001763 197 315 PS50206 Rhodanese-like

IPR001394 779 1112 PS50235 Peptidase C19

ScanRegExp IPR001394 780 795 PS00972 Peptidase C19

IPR001448 825 834 PS00304 Small acid-soluble spore protein

IPR001394 1053 1070 PS00973 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015063	8	115	PF08969	Domain of unknown function DUF1873
IPR001763	186	309	PF00581	Rhodanese-like
IPR001394	776	1108	PF00443	Peptidase C19
ProfileScan	IPR001763	197	315	PS50206	Rhodanese-like
IPR001394	779	1112	PS50235	Peptidase C19
ScanRegExp	IPR001394	780	795	PS00972	Peptidase C19
IPR001448	825	834	PS00304	Small acid-soluble spore protein
IPR001394	1053	1070	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TATTGCAGTGCCTATGTAACG
Primer_r	: TACCAAATTCTTCTGCCACTT
PCR product length	: 123 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	685 bp
Genome contig ID	gi51511731f_48403892
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- ATTTACAGCTACATTAAAATCTTAATGAGAAAAAT
Flanking genome sequence (175373 - 175422)	----+--------+--------+--------+--------+----* AATTTATAACCCTGTGGGTGTTCTGTCTTTAATATTGTATTATCAAATAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	48503892	48579263	20	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0055

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information