HUGE

Gene/Protein Characteristic Table for KIAA0529

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00553
Accession No. :	AB011101
Description :	Ubiquitin carboxyl-terminal hydrolase 15.
HUGO Gene Name :	ubiquitin specific peptidase 15 (USP15)
Clone Name :	hg02898s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0529
Source :	Human adult brain
Note :	We replaced hg02898, former representative clones for KIAA0529 with hg02898s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4602 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1743 bp

Genome contig ID gi89161190f_60840463
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTATATAGATTTCAATAAAGCTATTCAAGGCCTT
Flanking genome sequence
(245704 - 245753)
----+----*----+----*----+----*----+----*----+----*
ATTTAGTCTTTTATTTCTTACTCTTAATCTTTTAATAAAAATCCCCTACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 60940463 61086165 21 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 952 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001166420	99.9	ubiquitin speci...	Pan troglodytes
AAI25124	99.9	Ubiquitin speci...	Homo sapiens
AAI05522	98.7	Ubiquitin speci...	Bos taurus
EDM16533	98.1	ubiquitin speci...	Rattus norvegicus
AAF14188	97.9	deubiquitinatin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020698	1.1e-42	35.5	KIAA0891
D29956	5.8e-31	41.8	KIAA0055
AB029020	6.5e-15	23.9	KIAA1097
AB023220	5.2e-14	23.5	KIAA1003
AB033029	8.3e-09	43.6	KIAA1203

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010460 78 223 PF06337 Ubiquitin carboxyl-terminal hydrolase

IPR001394 257 901 PF00443 Peptidase C19

HMMSmart IPR006615 23 121 SM00695 Ubiquitin carboxyl-terminal hydrolase

ProfileScan IPR001394 260 905 PS50235 Peptidase C19

ScanRegExp IPR001394 261 276 PS00972 Peptidase C19

IPR001394 846 863 PS00973 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010460	78	223	PF06337	Ubiquitin carboxyl-terminal hydrolase
IPR001394	257	901	PF00443	Peptidase C19
HMMSmart	IPR006615	23	121	SM00695	Ubiquitin carboxyl-terminal hydrolase
ProfileScan	IPR001394	260	905	PS50235	Peptidase C19
ScanRegExp	IPR001394	261	276	PS00972	Peptidase C19
IPR001394	846	863	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTCTTTGTGTGTTCCTGATGG

Primer_r
: CCTGGATCCTTGAATGTGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCTTTGTGTGTTCCTGATGG
Primer_r	: CCTGGATCCTTGAATGTGGTG
PCR product length	: 168 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1743 bp
Genome contig ID	gi89161190f_60840463
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTATATAGATTTCAATAAAGCTATTCAAGGCCTT
Flanking genome sequence (245704 - 245753)	----+--------+--------+--------+--------+----* ATTTAGTCTTTTATTTCTTACTCTTAATCTTTTAATAAAAATCCCCTACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	60940463	61086165	21	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0529

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information