HUGE

Gene/Protein Characteristic Table for KIAA1003

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00164
Accession No. :	AB023220
Description :	Ubiquitin carboxyl-terminal hydrolase 20.
HUGO Gene Name :	ubiquitin specific peptidase 20 (USP20)
Clone Name :	hk09911 [Vector Info]
Flexi ORF Clone :	pF1KA1003
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4252 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1378 bp

Genome contig ID gi89161216f_131551910
PolyA signal sequence
(AATAAA,-10)
+----*----+----*----+----*----+----
GTTCAAAATGTCAGAATAAACACAGAATAAATGTT
Flanking genome sequence
(132020 - 132069)
----+----*----+----*----+----*----+----*----+----*
CCCACGGCCACACAGTCGTCTCTCCTTCACTGCAGTTCTGTTACTGGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 131651909 131683928 25 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW87911	99.9	ubiquitin speci...	Homo sapiens
AAL79676	100.0	pVHL-interactin...	Homo sapiens
AAH39593	99.9	Ubiquitin speci...	Homo sapiens
Q9Y2K6	99.8	Ubiquitin carbo...	Homo sapiens
XP_520313	99.3	ubiquitin speci...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029020	3e-125	60.0	KIAA1097
D29956	2.1e-11	29.8	KIAA0055
AB011101	4.7e-10	23.9	KIAA0529
AB020698	1.2e-08	24.5	KIAA0891
AB028986	1.4e-08	31.1	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001607 34 110 PF02148 Zinc finger

IPR001394 146 685 PF00443 Peptidase C19

HMMSmart IPR001607 33 85 SM00290 Zinc finger

IPR006615 705 788 SM00695 Ubiquitin carboxyl-terminal hydrolase

IPR006615 813 898 SM00695 Ubiquitin carboxyl-terminal hydrolase

ProfileScan IPR001607 32 96 PS50271 Zinc finger

IPR001394 149 689 PS50235 Peptidase C19

ScanRegExp IPR001394 150 165 PS00972 Peptidase C19

IPR001394 630 647 PS00973 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001607	34	110	PF02148	Zinc finger
IPR001394	146	685	PF00443	Peptidase C19
HMMSmart	IPR001607	33	85	SM00290	Zinc finger
IPR006615	705	788	SM00695	Ubiquitin carboxyl-terminal hydrolase
IPR006615	813	898	SM00695	Ubiquitin carboxyl-terminal hydrolase
ProfileScan	IPR001607	32	96	PS50271	Zinc finger
IPR001394	149	689	PS50235	Peptidase C19
ScanRegExp	IPR001394	150	165	PS00972	Peptidase C19
IPR001394	630	647	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCCACACTACTGCGTCTTTG

Primer_r
: ACAGAAGATCCGAAAAGTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCCACACTACTGCGTCTTTG
Primer_r	: ACAGAAGATCCGAAAAGTGAG
PCR product length	: 114 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1378 bp
Genome contig ID	gi89161216f_131551910
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- GTTCAAAATGTCAGAATAAACACAGAATAAATGTT
Flanking genome sequence (132020 - 132069)	----+--------+--------+--------+--------+----* CCCACGGCCACACAGTCGTCTCTCCTTCACTGCAGTTCTGTTACTGGAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	131651909	131683928	25	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1003

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information