HUGE |
Gene/Protein Characteristic Table for KIAA0189 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01660 |
---|---|
Accession No. : | D80011 |
Description : | StAR-related lipid transfer protein 8. |
HUGO Gene Name : | StAR-related lipid transfer (START) domain containing 8 (STARD8) |
Clone Name : | ha02928 [Vector Info] |
Flexi ORF Clone : | pF1KA0189
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4824 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1415 bp Genome contig ID gi89161218f_67730218 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
AGGATCCCTCAAATCAATAAAGCATTACCAGAGATFlanking genome sequence
(132184 - 132233) ----+----*----+----*----+----*----+----*----+----*
GCACTTTAACTGTGTGGCTGTCTTTGCTGACAATGGGCTAGGGACTGGGG
Features of the protein sequence |
Description | |
---|---|---|
Length: 1132 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: X |
: Genebridge 4 | |
: TAACATAACAGCCCCTTTCTC | |
: AGTGGGACAGAACAGGTTTGG | |
: 107 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |