HUGE

Gene/Protein Characteristic Table for KIAA0189

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01660
Accession No. :	D80011
Description :	StAR-related lipid transfer protein 8.
HUGO Gene Name :	StAR-related lipid transfer (START) domain containing 8 (STARD8)
Clone Name :	ha02928 [Vector Info]
Flexi ORF Clone :	pF1KA0189
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4824 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1415 bp

Genome contig ID gi89161218f_67730218
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AGGATCCCTCAAATCAATAAAGCATTACCAGAGAT
Flanking genome sequence
(132184 - 132233)
----+----*----+----*----+----*----+----*----+----*
GCACTTTAACTGTGTGGCTGTCTTTGCTGACAATGGGCTAGGGACTGGGG

Features of the protein sequence	Description

Length: 1132 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001135975	99.9	StAR-related li...	Homo sapiens
CAH18253	99.8	hypothetical pr...	Homo sapiens
XP_001082337	97.0	similar to STAR...	Macaca mulatta
BAG10301	100.0	START domain-co...	synthetic construct
Q92502	99.9	StAR-related li...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051510	8e-85	42.6	KIAA1723
D50921	2.1e-05	31.6	KIAA0131
AB051509	2.5e-05	23.8	KIAA1722
D87717	0.0001	31.3	KIAA0013
AB037735	0.00024	25.7	KIAA1314

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000198 695 844 PF00620 RhoGAP

IPR002913 927 1129 PF01852 Lipid-binding START

HMMSmart IPR000198 692 883 SM00324 RhoGAP

IPR002913 927 1129 SM00234 Lipid-binding START

ProfileScan IPR000198 682 886 PS50238 RhoGAP

IPR002913 931 1101 PS50848 Lipid-binding START

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000198	695	844	PF00620	RhoGAP
IPR002913	927	1129	PF01852	Lipid-binding START
HMMSmart	IPR000198	692	883	SM00324	RhoGAP
IPR002913	927	1129	SM00234	Lipid-binding START
ProfileScan	IPR000198	682	886	PS50238	RhoGAP
IPR002913	931	1101	PS50848	Lipid-binding START

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TAACATAACAGCCCCTTTCTC
Primer_r	: AGTGGGACAGAACAGGTTTGG
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1415 bp
Genome contig ID	gi89161218f_67730218
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AGGATCCCTCAAATCAATAAAGCATTACCAGAGAT
Flanking genome sequence (132184 - 132233)	----+--------+--------+--------+--------+----* GCACTTTAACTGTGTGGCTGTCTTTGCTGACAATGGGCTAGGGACTGGGG

Gene/Protein Characteristic Table for KIAA0189

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information