HUGE

Gene/Protein Characteristic Table for KIAA1314

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04157
Accession No. :	AB037735
Description :	Rho GTPase-activating protein 28.
HUGO Gene Name :	Rho GTPase activating protein 28 (ARHGAP28)
Clone Name :	fh12718 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5369 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO
Ensembl ContigView (Add our DAS server as a DAS source)
Content-type: text/html ¥¨¥é¡¼¡ª

fh12718 ¤Î¾ðÊó¤¬¥Ç¡¼¥¿¥Ù¡¼¥¹¤Ë¤¢¤ê¤Þ¤»¤ó¤Ç¤·¤¿¡£

¤â¤É¤ë

Features of the protein sequence	Description

Length: 681 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX01633	100.0	Rho GTPase acti...	Homo sapiens
EAX01634	99.1	Rho GTPase acti...	Homo sapiens
Q9P2N2	100.0	Rho GTPase-acti...	Homo sapiens
XP_512034	99.1	Rho GTPase acti...	Pan troglodytes
XP_547665	89.9	similar to Rho ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051510	2.1e-10	25.2	KIAA1723
D29642	3.9e-09	26.7	KIAA0053
AB051509	1.9e-08	29.3	KIAA1722
D80011	3.2e-08	26.1	KIAA0189
D87717	8.2e-08	26.2	KIAA0013

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000198 358 511 PF00620 RhoGAP

HMMSmart IPR000198 355 533 SM00324 RhoGAP

ProfileScan IPR000198 339 536 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000198	358	511	PF00620	RhoGAP
HMMSmart	IPR000198	355	533	SM00324	RhoGAP
ProfileScan	IPR000198	339	536	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCAAGACTTCAAAGGTACTG

Primer_r
: GAGAGAAGTGGAGCATGGACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCAAGACTTCAAAGGTACTG
Primer_r	: GAGAGAAGTGGAGCATGGACC
PCR product length	: 95(1.6k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA1314

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information