Gene/Protein Characteristic Table for KIAA0265

Length: 5551 bp

Restriction map

Length of 3'UTR	4345 bp
Genome contig ID	gi89161213f_129397647
PolyA signal sequence (None)	+----*----+----*----+----*----+---- CATCTTTTTGGTGTAATTTTCATGTTTTTAATTTG
Flanking genome sequence (164522 - 164571)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAAAACAACTTTTTATAAGTTTTTTAAGGGCCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	129497647	129562167	10	99.9	Perfect prediction

Length: 401 aa

Entry Exp ID% Protein Source XP_001094651 3e-158 92.6 similar to scru... Macaca mulatta Q5U3Y0 3.7e-155 92.3 Kelch domain-co... Rattus norvegicus Q0IIC2 5.7e-154 89.4 Kelch domain-co... Bos taurus XP_001503006 5.7e-154 89.7 hypothetical pr... Equus caballus AAH44884 9.5e-153 89.0 Kelch domain co... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB011106 1.4e-06 25.3 KIAA0534 AB037753 2.7e-06 26.4 KIAA1332 AB037730 1.9e-05 27.3 KIAA1309 AB037775 7.3e-05 25.5 KIAA1354 AB037805 0.0002 22.1 KIAA1384

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006652	50	107	PF01344	Kelch repeat type 1
	IPR011498	112	160	PF07646	Kelch repeat type 2
	IPR006652	165	210	PF01344	Kelch repeat type 1
	IPR006652	218	265	PF01344	Kelch repeat type 1
	IPR006652	274	319	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	230	285	SM00612	Kelch repeat type 1
	IPR006652	286	333	SM00612	Kelch repeat type 1

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-