HUGE

Gene/Protein Characteristic Table for KIAA1309

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05758
Accession No. :	AB037730
Description :	Kelch-like protein 13.
HUGO Gene Name :
Clone Name :	fh10381 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5331 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1094 bp

Genome contig ID gi89161218r_116815805
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTATCTTTTTTTGTTCAATAAAAACATTTAATGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTGGTCTGAGACATCCCATTATTGTCTGATTTGACTTCCTTTGATTA

Features of the protein sequence	Description

Length: 639 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAH13788	100.0	unnamed protein...	Homo sapiens
BAH12978	100.0	unnamed protein...	Homo sapiens
BAH12315	99.5	unnamed protein...	Homo sapiens
EAW89899	99.5	kelch-like 13 (...	Homo sapiens
AAH64576	98.4	Kelch-like 13 (...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037775	0	92.4	KIAA1354
AB037805	5.2e-71	33.8	KIAA1384
AB051474	6.7e-56	30.2	KIAA1687
AB040923	8.5e-55	29.7	KIAA1490
AB032955	4.1e-53	30.6	KIAA1129

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 66 175 PF00651 BTB/POZ

IPR011705 180 281 PF07707 BTB/Kelch-associated

IPR006652 313 360 PF01344 Kelch repeat type 1

IPR006652 362 412 PF01344 Kelch repeat type 1

IPR006652 414 459 PF01344 Kelch repeat type 1

IPR006652 461 506 PF01344 Kelch repeat type 1

IPR006652 508 558 PF01344 Kelch repeat type 1

IPR006652 562 607 PF01344 Kelch repeat type 1

HMMSmart IPR000210 76 175 SM00225 BTB/POZ-like

IPR006652 325 373 SM00612 Kelch repeat type 1

IPR006652 374 425 SM00612 Kelch repeat type 1

IPR006652 426 472 SM00612 Kelch repeat type 1

IPR006652 473 519 SM00612 Kelch repeat type 1

IPR006652 520 571 SM00612 Kelch repeat type 1

IPR006652 572 620 SM00612 Kelch repeat type 1

ProfileScan IPR000210 76 145 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	66	175	PF00651	BTB/POZ
IPR011705	180	281	PF07707	BTB/Kelch-associated
IPR006652	313	360	PF01344	Kelch repeat type 1
IPR006652	362	412	PF01344	Kelch repeat type 1
IPR006652	414	459	PF01344	Kelch repeat type 1
IPR006652	461	506	PF01344	Kelch repeat type 1
IPR006652	508	558	PF01344	Kelch repeat type 1
IPR006652	562	607	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	76	175	SM00225	BTB/POZ-like
IPR006652	325	373	SM00612	Kelch repeat type 1
IPR006652	374	425	SM00612	Kelch repeat type 1
IPR006652	426	472	SM00612	Kelch repeat type 1
IPR006652	473	519	SM00612	Kelch repeat type 1
IPR006652	520	571	SM00612	Kelch repeat type 1
IPR006652	572	620	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	76	145	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGACTGTGTGGGTGCATTGAG

Primer_r
: TAAGTAGAGGGTTCATGCTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGACTGTGTGGGTGCATTGAG
Primer_r	: TAAGTAGAGGGTTCATGCTGC
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1094 bp
Genome contig ID	gi89161218r_116815805
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTATCTTTTTTTGTTCAATAAAAACATTTAATGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTGGTCTGAGACATCCCATTATTGTCTGATTTGACTTCCTTTGATTA

Gene/Protein Characteristic Table for KIAA1309

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information