HUGE

Gene/Protein Characteristic Table for KIAA1490

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00850
Accession No. :	AB040923
Description :	Kelch-like protein 1.
HUGO Gene Name :	kelch-like 1 (Drosophila) (KLHL1)
Clone Name :	fj08103 [Vector Info]
Flexi ORF Clone :	pF1KSDA1490
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4115 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1108 bp

Genome contig ID gi51511729r_69072727
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
ATTACAATTAATAAATGATCAAAAAATTTGCATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCAGTGTATTTTTAATAAATTTTAAATCGAATGTAAGGATAAAGTCAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 69172727 69580592 11 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 749 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NR64	100.0	Kelch-like prot...	Homo sapiens
AAH22460	99.9	Kelch-like 1 (D...	Homo sapiens
XP_509677	98.9	kelch-like 1 pr...	Pan troglodytes
XP_001494749	97.3	similar to Kelc...	Equus caballus
XP_871735	96.3	similar to Kelc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051474	5.8e-127	65.9	KIAA1687
AB032955	1.2e-58	38.8	KIAA1129
D50922	4.6e-48	34.6	KIAA0132
AB037730	1.6e-35	29.9	KIAA1309
AB037775	4.3e-35	29.5	KIAA1354

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 203 310 PF00651 BTB/POZ

IPR011705 315 416 PF07707 BTB/Kelch-associated

IPR006652 460 494 PF01344 Kelch repeat type 1

IPR006652 496 541 PF01344 Kelch repeat type 1

IPR006652 543 588 PF01344 Kelch repeat type 1

IPR006652 590 635 PF01344 Kelch repeat type 1

IPR006652 637 688 PF01344 Kelch repeat type 1

IPR006652 690 735 PF01344 Kelch repeat type 1

HMMSmart IPR000210 213 310 SM00225 BTB/POZ-like

IPR006652 461 507 SM00612 Kelch repeat type 1

IPR006652 508 554 SM00612 Kelch repeat type 1

IPR006652 555 601 SM00612 Kelch repeat type 1

IPR006652 602 648 SM00612 Kelch repeat type 1

IPR006652 649 701 SM00612 Kelch repeat type 1

IPR006652 702 748 SM00612 Kelch repeat type 1

ProfileScan IPR000210 213 280 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	203	310	PF00651	BTB/POZ
IPR011705	315	416	PF07707	BTB/Kelch-associated
IPR006652	460	494	PF01344	Kelch repeat type 1
IPR006652	496	541	PF01344	Kelch repeat type 1
IPR006652	543	588	PF01344	Kelch repeat type 1
IPR006652	590	635	PF01344	Kelch repeat type 1
IPR006652	637	688	PF01344	Kelch repeat type 1
IPR006652	690	735	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	213	310	SM00225	BTB/POZ-like
IPR006652	461	507	SM00612	Kelch repeat type 1
IPR006652	508	554	SM00612	Kelch repeat type 1
IPR006652	555	601	SM00612	Kelch repeat type 1
IPR006652	602	648	SM00612	Kelch repeat type 1
IPR006652	649	701	SM00612	Kelch repeat type 1
IPR006652	702	748	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	213	280	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCTGCCTCATTTTCCTAAGC

Primer_r
: GTGTTTGCCAGTTTCAGATTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1108 bp
Genome contig ID	gi51511729r_69072727
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ATTACAATTAATAAATGATCAAAAAATTTGCATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCAGTGTATTTTTAATAAATTTTAAATCGAATGTAAGGATAAAGTCAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	69172727	69580592	11	99.7	Perfect prediction

Primer_f	: TTCTGCCTCATTTTCCTAAGC
Primer_r	: GTGTTTGCCAGTTTCAGATTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1490

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information