HUGE

Gene/Protein Characteristic Table for KIAA1687

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01177
Accession No. :	AB051474
Description :	Kelch-like protein 4.
HUGO Gene Name :	kelch-like 4 (Drosophila) (KLHL4)
Clone Name :	fh26020 [Vector Info]
Flexi ORF Clone :	pF1KA1687
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5800 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3515 bp

Genome contig ID gi89161218f_86559425
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AATTATAGTAATATTAATAAAAGTGTTAAAGCTTT
Flanking genome sequence
(252283 - 252332)
----+----*----+----*----+----*----+----*----+----*
TTCTCTCTTGACAATGCTTGCTTTTTAAGATTATGGCCTGCTACAGACTA

Features of the protein sequence	Description

Length: 728 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0H6	100.0	Kelch-like prot...	Homo sapiens
BAG51715	99.9	unnamed protein...	Homo sapiens
AAK49442	100.0	kelch-like prot...	Homo sapiens
XP_001500754	91.4	kelch-like 4 (D...	Equus caballus
CAM45987	88.0	kelch-like 4 (D...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040923	4.4e-156	65.7	KIAA1490
AB032955	4.6e-69	37.3	KIAA1129
AB037799	1.4e-67	37.7	KIAA1378
D50922	2.2e-57	34.0	KIAA0132
AB037730	4.5e-45	29.8	KIAA1309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR006651 485 498 PR00501 Kelch

IPR006651 549 563 PR00501 Kelch

IPR006651 564 576 PR00501 Kelch

HMMPfam IPR013069 182 289 PF00651 BTB/POZ

IPR011705 294 395 PF07707 BTB/Kelch-associated

IPR006652 439 473 PF01344 Kelch repeat type 1

IPR006652 475 520 PF01344 Kelch repeat type 1

IPR006652 522 567 PF01344 Kelch repeat type 1

IPR006652 569 614 PF01344 Kelch repeat type 1

IPR006652 616 667 PF01344 Kelch repeat type 1

IPR006652 669 714 PF01344 Kelch repeat type 1

HMMSmart IPR000210 192 289 SM00225 BTB/POZ-like

IPR006652 440 486 SM00612 Kelch repeat type 1

IPR006652 487 533 SM00612 Kelch repeat type 1

IPR006652 534 580 SM00612 Kelch repeat type 1

IPR006652 581 627 SM00612 Kelch repeat type 1

IPR006652 628 680 SM00612 Kelch repeat type 1

IPR006652 681 727 SM00612 Kelch repeat type 1

ProfileScan IPR000210 192 259 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	485	498	PR00501	Kelch
IPR006651	549	563	PR00501	Kelch
IPR006651	564	576	PR00501	Kelch
HMMPfam	IPR013069	182	289	PF00651	BTB/POZ
IPR011705	294	395	PF07707	BTB/Kelch-associated
IPR006652	439	473	PF01344	Kelch repeat type 1
IPR006652	475	520	PF01344	Kelch repeat type 1
IPR006652	522	567	PF01344	Kelch repeat type 1
IPR006652	569	614	PF01344	Kelch repeat type 1
IPR006652	616	667	PF01344	Kelch repeat type 1
IPR006652	669	714	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	192	289	SM00225	BTB/POZ-like
IPR006652	440	486	SM00612	Kelch repeat type 1
IPR006652	487	533	SM00612	Kelch repeat type 1
IPR006652	534	580	SM00612	Kelch repeat type 1
IPR006652	581	627	SM00612	Kelch repeat type 1
IPR006652	628	680	SM00612	Kelch repeat type 1
IPR006652	681	727	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	192	259	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAATAGGCAAGGAGAACTGGG

Primer_r
: TTTGTCCGAGGGCTTTGCATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3515 bp
Genome contig ID	gi89161218f_86559425
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AATTATAGTAATATTAATAAAAGTGTTAAAGCTTT
Flanking genome sequence (252283 - 252332)	----+--------+--------+--------+--------+----* TTCTCTCTTGACAATGCTTGCTTTTTAAGATTATGGCCTGCTACAGACTA

Primer_f	: GAATAGGCAAGGAGAACTGGG
Primer_r	: TTTGTCCGAGGGCTTTGCATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1687

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information