| HUGE |
Gene/Protein Characteristic Table for KIAA0132 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00420 |
|---|---|
| Accession No. : | D50922 |
| Description : | Kelch-like ECH-associated protein 1. |
| HUGO Gene Name : | kelch-like ECH-associated protein 1 (KEAP1) |
| Clone Name : | ha01449s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0132
|
| Source : | Myeloblast cell line (KG-1) |
| Note : | We replaced ha01449, former representative clones for KIAA0132 with ha01449s1. (2008/12/19) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2513 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 526 bp Genome contig ID gi42406306r_10357802 PolyA signal sequence
(AATAAA,-29)
AAGGAAAATAAAGAACAGACTAACTAGTGTCTTTCFlanking genome sequence
(100000 - 99951)
ACCCTGGCTCTGGGCTGGAGGCCTGAAACCGGGGGCCAGAAAGGGCTCTT
Features of the protein sequence |
Description | |
|---|---|---|
Length: 637 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 19 |
| : Genebridge 4 | |
| : TTACGACCCAGATACAGACAC | |
| : TTCTGCTGGTCAATCTGCTTC | |
| : 114 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
