HUGE

Gene/Protein Characteristic Table for KIAA1378

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00223
Accession No. :	AB037799
Description :	Kelch-like protein 8.
HUGO Gene Name :	kelch-like 8 (Drosophila) (KLHL8)
Clone Name :	fj04831s1 [Vector Info]
Flexi ORF Clone :	pF1KA1378
Source :	Human fetal brain
Note :	We replaced fj04831, former representative clones for KIAA1378 with fj04831s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4345 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2457 bp

Genome contig ID gi89161207r_88201520
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCGGTGAAACAAGAGTGAAACTCCATCTC
Flanking genome sequence
(99718 - 99669)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGATAAAAAAGCAGAATCAATATGTGCACAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 88301238 88335740 9 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 628 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2G9	100.0	Kelch-like prot...	Homo sapiens
XP_001157304	99.8	kelch-like 8 is...	Pan troglodytes
CAD98048	99.8	hypothetical pr...	Homo sapiens
BAG54740	99.8	unnamed protein...	Homo sapiens
AAH41384	99.8	Kelch-like 8 (D...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051474	1.5e-78	37.7	KIAA1687
AB032955	2.3e-74	39.0	KIAA1129
AB018338	2.4e-59	34.9	KIAA0795
D50922	2.8e-58	31.9	KIAA0132
AB037730	4.5e-38	27.1	KIAA1309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR006651 373 386 PR00501 Kelch

IPR006651 484 498 PR00501 Kelch

IPR006651 546 558 PR00501 Kelch

HMMPfam IPR013069 65 172 PF00651 BTB/POZ

IPR011705 177 279 PF07707 BTB/Kelch-associated

IPR006652 326 361 PF01344 Kelch repeat type 1

IPR006652 363 408 PF01344 Kelch repeat type 1

IPR006652 410 455 PF01344 Kelch repeat type 1

IPR006652 457 502 PF01344 Kelch repeat type 1

IPR006652 504 549 PF01344 Kelch repeat type 1

IPR006652 551 596 PF01344 Kelch repeat type 1

HMMSmart IPR000210 75 172 SM00225 BTB/POZ-like

IPR006652 327 374 SM00612 Kelch repeat type 1

IPR006652 375 421 SM00612 Kelch repeat type 1

IPR006652 422 468 SM00612 Kelch repeat type 1

IPR006652 469 515 SM00612 Kelch repeat type 1

IPR006652 516 562 SM00612 Kelch repeat type 1

IPR006652 563 609 SM00612 Kelch repeat type 1

ProfileScan IPR000210 75 142 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	373	386	PR00501	Kelch
IPR006651	484	498	PR00501	Kelch
IPR006651	546	558	PR00501	Kelch
HMMPfam	IPR013069	65	172	PF00651	BTB/POZ
IPR011705	177	279	PF07707	BTB/Kelch-associated
IPR006652	326	361	PF01344	Kelch repeat type 1
IPR006652	363	408	PF01344	Kelch repeat type 1
IPR006652	410	455	PF01344	Kelch repeat type 1
IPR006652	457	502	PF01344	Kelch repeat type 1
IPR006652	504	549	PF01344	Kelch repeat type 1
IPR006652	551	596	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	75	172	SM00225	BTB/POZ-like
IPR006652	327	374	SM00612	Kelch repeat type 1
IPR006652	375	421	SM00612	Kelch repeat type 1
IPR006652	422	468	SM00612	Kelch repeat type 1
IPR006652	469	515	SM00612	Kelch repeat type 1
IPR006652	516	562	SM00612	Kelch repeat type 1
IPR006652	563	609	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	75	142	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 84 KLISCHKLVLACVIPYFRAMFLS 106 PRIMARY 23

2 144 NVQPLLYAACILQVELVARACCE 166 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	84	KLISCHKLVLACVIPYFRAMFLS	106	PRIMARY	23
2	144	NVQPLLYAACILQVELVARACCE	166	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTTGATCCAGTGCTGAATAG

Primer_r
: GCCAGAACTCAAATCACATAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2457 bp
Genome contig ID	gi89161207r_88201520
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCGGTGAAACAAGAGTGAAACTCCATCTC
Flanking genome sequence (99718 - 99669)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGATAAAAAAGCAGAATCAATATGTGCACAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	88301238	88335740	9	99.4	Perfect prediction

Primer_f	: GTTTGATCCAGTGCTGAATAG
Primer_r	: GCCAGAACTCAAATCACATAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1378

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information