HUGE

Gene/Protein Characteristic Table for KIAA0795

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05760
Accession No. :	AB018338
Description :	Kelch-like protein 18.
HUGO Gene Name :	kelch-like 18 (Drosophila) (KLHL18)
Clone Name :	hk06104 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4273 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2874 bp

Genome contig ID gi89161205f_47239128
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGAAACCAAAGAGAAATAAAGAGAACACTCCTAAT
Flanking genome sequence
(124183 - 124232)
----+----*----+----*----+----*----+----*----+----*
AGCTCTTGTCCTTTCTTGGTTTATTTCTCAGATATTAGAAGTACATGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 47339128 47363309 8 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 465 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB93503	1e-207	100.0	OK/SW-CL.74 [Ho...	Homo sapiens
O94889	1.1e-207	100.0	Kelch-like prot...	Homo sapiens
CAD97920	1.1e-207	100.0	hypothetical pr...	Homo sapiens
BAG58276	1e-206	100.0	unnamed protein...	Homo sapiens
XP_001100798	4.8e-205	99.4	similar to kelc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032955	2.1e-71	39.1	KIAA1129
AB037799	4.5e-63	34.9	KIAA1378
D50922	1.4e-58	35.7	KIAA0132
AB067508	2.3e-46	32.1	KIAA1921
AB037730	2.1e-44	31.7	KIAA1309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR006651 273 286 PR00501 Kelch

IPR006651 290 304 PR00501 Kelch

IPR006651 305 317 PR00501 Kelch

HMMPfam IPR011705 31 133 PF07707 BTB/Kelch-associated

IPR006652 168 214 PF01344 Kelch repeat type 1

IPR006652 216 261 PF01344 Kelch repeat type 1

IPR006652 263 308 PF01344 Kelch repeat type 1

IPR006652 310 355 PF01344 Kelch repeat type 1

IPR006652 357 402 PF01344 Kelch repeat type 1

IPR006652 404 449 PF01344 Kelch repeat type 1

HMMSmart IPR006652 180 227 SM00612 Kelch repeat type 1

IPR006652 228 274 SM00612 Kelch repeat type 1

IPR006652 275 321 SM00612 Kelch repeat type 1

IPR006652 322 368 SM00612 Kelch repeat type 1

IPR006652 369 415 SM00612 Kelch repeat type 1

IPR006652 416 462 SM00612 Kelch repeat type 1

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	273	286	PR00501	Kelch
IPR006651	290	304	PR00501	Kelch
IPR006651	305	317	PR00501	Kelch
HMMPfam	IPR011705	31	133	PF07707	BTB/Kelch-associated
IPR006652	168	214	PF01344	Kelch repeat type 1
IPR006652	216	261	PF01344	Kelch repeat type 1
IPR006652	263	308	PF01344	Kelch repeat type 1
IPR006652	310	355	PF01344	Kelch repeat type 1
IPR006652	357	402	PF01344	Kelch repeat type 1
IPR006652	404	449	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	180	227	SM00612	Kelch repeat type 1
IPR006652	228	274	SM00612	Kelch repeat type 1
IPR006652	275	321	SM00612	Kelch repeat type 1
IPR006652	322	368	SM00612	Kelch repeat type 1
IPR006652	369	415	SM00612	Kelch repeat type 1
IPR006652	416	462	SM00612	Kelch repeat type 1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGATGTAACAAGGAGATAGGG

Primer_r
: ATCCAGAAGAGAAGGCCCGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2874 bp
Genome contig ID	gi89161205f_47239128
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGAAACCAAAGAGAAATAAAGAGAACACTCCTAAT
Flanking genome sequence (124183 - 124232)	----+--------+--------+--------+--------+----* AGCTCTTGTCCTTTCTTGGTTTATTTCTCAGATATTAGAAGTACATGTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	47339128	47363309	8	99.2	Perfect prediction

Primer_f	: GGATGTAACAAGGAGATAGGG
Primer_r	: ATCCAGAAGAGAAGGCCCGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0795

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information