HUGE

Gene/Protein Characteristic Table for KIAA1921

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05768
Accession No. :	AB067508
Description :	Kelch-like protein 29.
HUGO Gene Name :	kelch-like 29 (Drosophila) (KLHL29)
Clone Name :	fg00938 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6385 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1947 bp

Genome contig ID gi89161199f_23665160
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TATTATAATAAATATATTTATAGATCTAGACTTGG
Flanking genome sequence
(119827 - 119876)
----+----*----+----*----+----*----+----*----+----*
AAGCCAACGTAATCTTTGTGTGCCATCGTCCTGCCACAGGGATGCAAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 23765160 23784985 8 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 545 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96CT2	99.6	Kelch-like prot...	Homo sapiens
AAH13982	99.6	KLHL29 protein ...	Homo sapiens
EAX00787	99.6	hCG1783917, iso...	Homo sapiens
EAX00791	99.6	hCG1783917, iso...	Homo sapiens
EAX00793	99.6	hCG1783917, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032955	8.4e-53	31.5	KIAA1129
AB018338	1.3e-45	32.1	KIAA0795
AB037799	2.4e-39	29.2	KIAA1378
AB007938	3.2e-37	34.6	KIAA0469
AB040923	4.4e-37	29.6	KIAA1490

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 26 101 PF00651 BTB/POZ

IPR011705 106 208 PF07707 BTB/Kelch-associated

IPR011498 243 292 PF07646 Kelch repeat type 2

IPR006652 295 340 PF01344 Kelch repeat type 1

IPR006652 342 387 PF01344 Kelch repeat type 1

IPR006652 389 435 PF01344 Kelch repeat type 1

IPR006652 480 527 PF01344 Kelch repeat type 1

HMMSmart IPR006652 255 306 SM00612 Kelch repeat type 1

IPR006652 307 353 SM00612 Kelch repeat type 1

IPR006652 354 400 SM00612 Kelch repeat type 1

IPR006652 401 448 SM00612 Kelch repeat type 1

IPR006652 449 491 SM00612 Kelch repeat type 1

IPR006652 492 540 SM00612 Kelch repeat type 1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	26	101	PF00651	BTB/POZ
IPR011705	106	208	PF07707	BTB/Kelch-associated
IPR011498	243	292	PF07646	Kelch repeat type 2
IPR006652	295	340	PF01344	Kelch repeat type 1
IPR006652	342	387	PF01344	Kelch repeat type 1
IPR006652	389	435	PF01344	Kelch repeat type 1
IPR006652	480	527	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	255	306	SM00612	Kelch repeat type 1
IPR006652	307	353	SM00612	Kelch repeat type 1
IPR006652	354	400	SM00612	Kelch repeat type 1
IPR006652	401	448	SM00612	Kelch repeat type 1
IPR006652	449	491	SM00612	Kelch repeat type 1
IPR006652	492	540	SM00612	Kelch repeat type 1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCGCTGTTGAGTTGAAGTTGG

Primer_r
: TCGTAGTGCTAGAAGTTGATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1947 bp
Genome contig ID	gi89161199f_23665160
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TATTATAATAAATATATTTATAGATCTAGACTTGG
Flanking genome sequence (119827 - 119876)	----+--------+--------+--------+--------+----* AAGCCAACGTAATCTTTGTGTGCCATCGTCCTGCCACAGGGATGCAAAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	23765160	23784985	8	99.1	Perfect prediction

Primer_f	: GCGCTGTTGAGTTGAAGTTGG
Primer_r	: TCGTAGTGCTAGAAGTTGATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1921

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information