HUGE

Gene/Protein Characteristic Table for KIAA0469

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05763
Accession No. :	AB007938
Description :	Kelch-like protein 21.
HUGO Gene Name :	kelch-like 21 (Drosophila) (KLHL21)
Clone Name :	hg01666 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6450 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4646 bp

Genome contig ID gi89161185r_6473366
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
ACTTTTTGCAATAAAAGTATTTCCTATCCATTTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCATTGCCTTTGTCCTCCTGCTACTGTCTTCTGGGACTCTTGGGCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 6573366 6585648 3 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 559 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI16082	0	99.8	kelch-like 21 (...	Homo sapiens
Q9UJP4	2.9e-214	99.8	Kelch-like prot...	Homo sapiens
BAG52104	1.1e-213	99.6	unnamed protein...	Homo sapiens
XP_001094118	1.1e-213	99.4	similar to kelc...	Macaca mulatta
XP_546754	4.5e-212	98.4	similar to kelc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032955	6e-39	30.6	KIAA1129
AB051474	6.1e-37	30.4	KIAA1687
AB040923	2.6e-35	28.8	KIAA1490
AB067508	9.7e-33	34.8	KIAA1921
AB037799	3.6e-30	27.1	KIAA1378

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 45 153 PF00651 BTB/POZ

IPR011705 158 259 PF07707 BTB/Kelch-associated

IPR006652 295 341 PF01344 Kelch repeat type 1

IPR006652 344 389 PF01344 Kelch repeat type 1

IPR006652 391 429 PF01344 Kelch repeat type 1

IPR006652 431 475 PF01344 Kelch repeat type 1

IPR006652 502 519 PF01344 Kelch repeat type 1

HMMSmart IPR000210 55 153 SM00225 BTB/POZ-like

IPR006652 307 354 SM00612 Kelch repeat type 1

IPR006652 356 402 SM00612 Kelch repeat type 1

IPR006652 403 442 SM00612 Kelch repeat type 1

ProfileScan IPR000210 55 123 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	45	153	PF00651	BTB/POZ
IPR011705	158	259	PF07707	BTB/Kelch-associated
IPR006652	295	341	PF01344	Kelch repeat type 1
IPR006652	344	389	PF01344	Kelch repeat type 1
IPR006652	391	429	PF01344	Kelch repeat type 1
IPR006652	431	475	PF01344	Kelch repeat type 1
IPR006652	502	519	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	55	153	SM00225	BTB/POZ-like
IPR006652	307	354	SM00612	Kelch repeat type 1
IPR006652	356	402	SM00612	Kelch repeat type 1
IPR006652	403	442	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	55	123	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
:

Primer_r
:

PCR conditions
: °C sec °C sec cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCTGGGGTGAACTGGATGTG
Primer_r	: ATAGATGTTGGGATGCCTGGG
PCR product length	: 202 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	4646 bp
Genome contig ID	gi89161185r_6473366
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ACTTTTTGCAATAAAAGTATTTCCTATCCATTTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCATTGCCTTTGTCCTCCTGCTACTGTCTTCTGGGACTCTTGGGCTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	6573366	6585648	3	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0469

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information