HUGE |
Gene/Protein Characteristic Table for KIAA0469 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05763 |
---|---|
Accession No. : | AB007938 |
Description : | Kelch-like protein 21. |
HUGO Gene Name : | kelch-like 21 (Drosophila) (KLHL21) |
Clone Name : | hg01666 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6450 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 4646 bp Genome contig ID gi89161185r_6473366 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
ACTTTTTGCAATAAAAGTATTTCCTATCCATTTGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTCATTGCCTTTGTCCTCCTGCTACTGTCTTCTGGGACTCTTGGGCTGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 6573366 6585648 3 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 559 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: | |
: | |
: °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CTCTGGGGTGAACTGGATGTG | |
: ATAGATGTTGGGATGCCTGGG | |
: 202 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |