HUGE

Gene/Protein Characteristic Table for KIAA1354

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05773
Accession No. :	AB037775
Description :	Kelch-like protein 9.
HUGO Gene Name :	kelch-like 9 (Drosophila) (KLHL9)
Clone Name :	fj01502 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4352 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1988 bp

Genome contig ID gi89161216r_21221019
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GGATCTCTTTATATAATAAATGTAATTTAACTTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTGCTTGCATTTATTTCTTCCCTCAATCTGTTGTAGTTTTACAAAGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 21321019 21325368 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_538682	98.9	similar to kelc...	Canis lupus fam...
Q9P2J3	100.0	Kelch-like prot...	Homo sapiens
AAO39718	99.5	KLHL9 protein [...	Homo sapiens
Q2T9Z7	99.7	Kelch-like prot...	Bos taurus
EDL97739	99.2	kelch-like 9 (D...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037730	0	92.4	KIAA1309
AB037805	2.9e-67	33.4	KIAA1384
AB051474	4.4e-52	31.0	KIAA1687
AB040923	1.2e-51	29.3	KIAA1490
AB032955	9.9e-50	30.4	KIAA1129

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 55 164 PF00651 BTB/POZ

IPR011705 169 270 PF07707 BTB/Kelch-associated

IPR006652 302 349 PF01344 Kelch repeat type 1

IPR006652 351 401 PF01344 Kelch repeat type 1

IPR006652 403 448 PF01344 Kelch repeat type 1

IPR006652 450 495 PF01344 Kelch repeat type 1

IPR006652 497 547 PF01344 Kelch repeat type 1

IPR006652 551 596 PF01344 Kelch repeat type 1

HMMSmart IPR000210 65 164 SM00225 BTB/POZ-like

IPR006652 314 362 SM00612 Kelch repeat type 1

IPR006652 363 414 SM00612 Kelch repeat type 1

IPR006652 415 461 SM00612 Kelch repeat type 1

IPR006652 462 508 SM00612 Kelch repeat type 1

IPR006652 509 560 SM00612 Kelch repeat type 1

IPR006652 561 609 SM00612 Kelch repeat type 1

ProfileScan IPR000210 65 134 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	55	164	PF00651	BTB/POZ
IPR011705	169	270	PF07707	BTB/Kelch-associated
IPR006652	302	349	PF01344	Kelch repeat type 1
IPR006652	351	401	PF01344	Kelch repeat type 1
IPR006652	403	448	PF01344	Kelch repeat type 1
IPR006652	450	495	PF01344	Kelch repeat type 1
IPR006652	497	547	PF01344	Kelch repeat type 1
IPR006652	551	596	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	65	164	SM00225	BTB/POZ-like
IPR006652	314	362	SM00612	Kelch repeat type 1
IPR006652	363	414	SM00612	Kelch repeat type 1
IPR006652	415	461	SM00612	Kelch repeat type 1
IPR006652	462	508	SM00612	Kelch repeat type 1
IPR006652	509	560	SM00612	Kelch repeat type 1
IPR006652	561	609	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	65	134	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACAGGACCAACTTCAGATTC

Primer_r
: TTCCTGTAACTCCATTTGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1988 bp
Genome contig ID	gi89161216r_21221019
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GGATCTCTTTATATAATAAATGTAATTTAACTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGCTTGCATTTATTTCTTCCCTCAATCTGTTGTAGTTTTACAAAGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	21321019	21325368	1	99.0	Perfect prediction

Primer_f	: GACAGGACCAACTTCAGATTC
Primer_r	: TTCCTGTAACTCCATTTGCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1354

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information