HUGE

Gene/Protein Characteristic Table for KIAA0270

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06265
Accession No. :	D87460
Description :	Paralemmin.
HUGO Gene Name :	paralemmin (PALM)
Clone Name :	ha06636 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2552 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1514 bp

Genome contig ID gi42406306f_578562
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TCCCAGAGAAGCAAATAAACAGCGTGAACAGCCCC
Flanking genome sequence
(120768 - 120817)
----+----*----+----*----+----*----+----*----+----*
AGTTCCTGGAGTTCTTGCCTTTCAACCTGGCGAGGAAGGCGTGGCCAGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 678555 699328 6 99.0 Terminal No-hit

Features of the protein sequence	Description

Length: 345 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75781	6.8e-114	100.0	Paralemmin.	Homo sapiens
CAA76151	1.3e-113	99.7	paralemin [Homo...	Homo sapiens
BAG37611	2.1e-113	99.7	unnamed protein...	Homo sapiens
XP_524021	1e-112	99.1	paralemmin [Pan...	Pan troglodytes
XP_001253885	1.3e-94	83.5	similar to para...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023137	5.1e-05	27.6	KIAA0920

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004965 28 345 PF03285 Paralemmin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004965	28	345	PF03285	Paralemmin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGCCCCCTCTCATTGGAAGTG
Primer_r	: TGTCCAAAGCCAACGTGTGAG
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1514 bp
Genome contig ID	gi42406306f_578562
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCCCAGAGAAGCAAATAAACAGCGTGAACAGCCCC
Flanking genome sequence (120768 - 120817)	----+--------+--------+--------+--------+----* AGTTCCTGGAGTTCTTGCCTTTCAACCTGGCGAGGAAGGCGTGGCCAGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	678555	699328	6	99.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0270

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information