HUGE

Gene/Protein Characteristic Table for KIAA0320

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07125
Accession No. :	AB002318
Description :	Talin-2.
HUGO Gene Name :	talin 2 (TLN2)
Clone Name :	bg00151 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg00411, former representative clones for KIAA0320 with bg00151. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6674 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 871 bp

Genome contig ID gi51511731f_60681613
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TGGGGATTCTGCTGGAATAAAGAGCTTCCTCAGTG
Flanking genome sequence
(239122 - 239171)
----+----*----+----*----+----*----+----*----+----*
ACTCATCTTTAGGTCCCACGCTGGTTTCTGTGCCTTCAGAATGGTCACAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 60781613 60920733 42 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1933 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW77617	100.0	talin 2, isofor...	Homo sapiens
NP_055874	100.0	talin 2 [Homo s...	Homo sapiens
Q9Y4G6	100.0	Talin-2.	Homo sapiens
AAM73764	99.9	talin 2 [Homo s...	Homo sapiens
XP_510461	99.7	talin 2 isoform...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028950	0	74.3	KIAA1027
AB014555	4.1e-13	25.8	KIAA0655

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002558 62 156 PD011820 I/LWEQ

IPR002558 815 1015 PD011820 I/LWEQ

IPR002558 1688 1921 PD011820 I/LWEQ

HMMPfam IPR015224 1 46 PF09141 Talin

IPR015009 1241 1365 PF08913 Vinculin Binding Site

IPR015009 1403 1465 PF08913 Vinculin Binding Site

IPR002558 1733 1924 PF01608 I/LWEQ

HMMSmart IPR002558 1728 1924 SM00307 I/LWEQ

ProfileScan IPR002558 1685 1924 PS50945 I/LWEQ

ScanRegExp IPR006650 1460 1466 PS00485 Adenosine/AMP deaminase active site

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002558	62	156	PD011820	I/LWEQ
IPR002558	815	1015	PD011820	I/LWEQ
IPR002558	1688	1921	PD011820	I/LWEQ
HMMPfam	IPR015224	1	46	PF09141	Talin
IPR015009	1241	1365	PF08913	Vinculin Binding Site
IPR015009	1403	1465	PF08913	Vinculin Binding Site
IPR002558	1733	1924	PF01608	I/LWEQ
HMMSmart	IPR002558	1728	1924	SM00307	I/LWEQ
ProfileScan	IPR002558	1685	1924	PS50945	I/LWEQ
ScanRegExp	IPR006650	1460	1466	PS00485	Adenosine/AMP deaminase active site

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGATACGACACAGGGCAGAG

Primer_r
: TCATCCCACAAAACACGAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAGATACGACACAGGGCAGAG
Primer_r	: TCATCCCACAAAACACGAGGC
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	871 bp
Genome contig ID	gi51511731f_60681613
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGGGGATTCTGCTGGAATAAAGAGCTTCCTCAGTG
Flanking genome sequence (239122 - 239171)	----+--------+--------+--------+--------+----* ACTCATCTTTAGGTCCCACGCTGGTTTCTGTGCCTTCAGAATGGTCACAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	60781613	60920733	42	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0320

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information