HUGE

Gene/Protein Characteristic Table for KIAA0655

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00593
Accession No. :	AB014555
Description :	Huntingtin-interacting protein 1-related protein.
HUGO Gene Name :	huntingtin interacting protein 1 related (HIP1R)
Clone Name :	hk01768 [Vector Info]
Flexi ORF Clone :	pF1KSDA0655
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4457 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1083 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75146	100.0	Huntingtin-inte...	Homo sapiens
CAH90311	98.4	hypothetical pr...	Pongo abelii
EDM13611	91.9	rCG21182, isofo...	Rattus norvegicus
NP_001128235	91.9	huntingtin inte...	Rattus norvegicus
XP_585048	90.8	similar to Hunt...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028950	3.8e-06	22.7	KIAA1027
AB002318	7e-06	25.8	KIAA0320

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002558 768 1083 PD011820 I/LWEQ

HMMPfam IPR011417 43 315 PF07651 ANTH

IPR002558 834 1027 PF01608 I/LWEQ

HMMSmart IPR013809 44 166 SM00273 Epsin-like

IPR002558 829 1027 SM00307 I/LWEQ

ProfileScan IPR013809 38 166 PS50942 Epsin-like

IPR002558 786 1027 PS50945 I/LWEQ

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002558	768	1083	PD011820	I/LWEQ
HMMPfam	IPR011417	43	315	PF07651	ANTH
IPR002558	834	1027	PF01608	I/LWEQ
HMMSmart	IPR013809	44	166	SM00273	Epsin-like
IPR002558	829	1027	SM00307	I/LWEQ
ProfileScan	IPR013809	38	166	PS50942	Epsin-like
IPR002558	786	1027	PS50945	I/LWEQ

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTTCTGGGGCACCGATTCTA

Primer_r
: ACATTCCTCTAGCCCACACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTTCTGGGGCACCGATTCTA
Primer_r	: ACATTCCTCTAGCCCACACAG
PCR product length	: 80 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0655

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information