HUGE

Gene/Protein Characteristic Table for KIAA1027

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01622
Accession No. :	AB028950
Description :	Talin-1.
HUGO Gene Name :
Clone Name :	fh00156s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1027
Source :	Human fetal brain
Note :	We replaced fh00156, former representative clones for KIAA1027 with fh00156s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8405 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 450 bp

Genome contig ID gi89161216r_35587338
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AAACAGGTCATGCTCCAATAAAAATGATTCTACCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAACCTCTGCCTGGCTTCAAGGGAGATACAAGTTTTCTCCCAGGGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 35687338 35722367 57 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y490	100.0	Talin-1.	Homo sapiens
AAH42923	100.0	Talin 1 [Homo s...	Homo sapiens
AAF27330	100.0	talin [Homo sap...	Homo sapiens
EAW58353	99.9	talin 1, isofor...	Homo sapiens
AAF23322	99.8	talin [Homo sap...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002318	0	74.3	KIAA0320
AB014555	4.3e-12	22.6	KIAA0655
AB002336	0.0003	20.7	KIAA0338

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002558 700 771 PD011820 I/LWEQ

IPR002558 1430 1628 PD011820 I/LWEQ

IPR002558 2305 2539 PD011820 I/LWEQ

HMMPfam IPR000299 130 322 PF00373 Band 4.1

IPR015224 500 661 PF09141 Talin

IPR015009 1243 1352 PF08913 Vinculin Binding Site

IPR015009 1858 1982 PF08913 Vinculin Binding Site

IPR002558 2350 2542 PF01608 I/LWEQ

HMMSmart IPR000299 91 322 SM00295 Band 4.1

IPR002558 2345 2542 SM00307 I/LWEQ

ProfileScan IPR000299 95 412 PS50057 Band 4.1

IPR002558 2302 2542 PS50945 I/LWEQ

ScanRegExp IPR000299 182 210 PS00660 Band 4.1

IPR000299 292 321 PS00661 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002558	700	771	PD011820	I/LWEQ
IPR002558	1430	1628	PD011820	I/LWEQ
IPR002558	2305	2539	PD011820	I/LWEQ
HMMPfam	IPR000299	130	322	PF00373	Band 4.1
IPR015224	500	661	PF09141	Talin
IPR015009	1243	1352	PF08913	Vinculin Binding Site
IPR015009	1858	1982	PF08913	Vinculin Binding Site
IPR002558	2350	2542	PF01608	I/LWEQ
HMMSmart	IPR000299	91	322	SM00295	Band 4.1
IPR002558	2345	2542	SM00307	I/LWEQ
ProfileScan	IPR000299	95	412	PS50057	Band 4.1
IPR002558	2302	2542	PS50945	I/LWEQ
ScanRegExp	IPR000299	182	210	PS00660	Band 4.1
IPR000299	292	321	PS00661	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAAAGAGAAGATGGTTGGCG

Primer_r
: AAACTTGTACTGCTGCTGCCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGAAAGAGAAGATGGTTGGCG
Primer_r	: AAACTTGTACTGCTGCTGCCG
PCR product length	: 128 (0.3k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	450 bp
Genome contig ID	gi89161216r_35587338
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAACAGGTCATGCTCCAATAAAAATGATTCTACCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAACCTCTGCCTGGCTTCAAGGGAGATACAAGTTTTCTCCCAGGGCAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	35687338	35722367	57	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1027

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information