HUGE

Gene/Protein Characteristic Table for KIAA0341

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00510
Accession No. :	AB002339
Description :	NEDD4-binding protein 3.
HUGO Gene Name :
Clone Name :	hg01438 [Vector Info]
Flexi ORF Clone :	pF1KSDA0341
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5721 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4078 bp

Genome contig ID gi51511721f_177379183
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGTAGAAAATCTTACACAATAAAGGACTTCAAAAT
Flanking genome sequence
(106505 - 106554)
----+----*----+----*----+----*----+----*----+----*
AAGGGTAAGGAAGGATGCTTTAACAAGCGGTGCTGGGATAACTGGATAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 177479183 177485686 4 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 546 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09710	6e-182	100.0	NEDD4-binding p...	synthetic construct
O15049	3.2e-181	99.8	NEDD4-binding p...	Homo sapiens
AAH53323	6.6e-181	99.6	Nedd4 binding p...	Homo sapiens
XP_001146257	2.2e-180	99.3	Nedd4 binding p...	Pan troglodytes
XP_001093839	2.4e-173	95.8	Nedd4 binding p...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011124	3.5e-09	31.8	KIAA0552
AB058716	8.8e-06	32.4	KIAA1813

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009638 368 529 PF06818 Fez1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009638	368	529	PF06818	Fez1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCTATTTCTGGCTCTTCATTC

Primer_r
: GATCTGCTTTCACAATAACCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTATTTCTGGCTCTTCATTC
Primer_r	: GATCTGCTTTCACAATAACCG
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4078 bp
Genome contig ID	gi51511721f_177379183
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTAGAAAATCTTACACAATAAAGGACTTCAAAAT
Flanking genome sequence (106505 - 106554)	----+--------+--------+--------+--------+----* AAGGGTAAGGAAGGATGCTTTAACAAGCGGTGCTGGGATAACTGGATAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	177479183	177485686	4	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0341

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information