HUGE

Gene/Protein Characteristic Table for KIAA0552

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00560
Accession No. :	AB011124
Description :
HUGO Gene Name :
Clone Name :	hh00869 [Vector Info]
Flexi ORF Clone :	pF1KSDA0552
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5257 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1827 bp

Genome contig ID gi51511747r_2991273
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTCCTTTCCCAAAGAAATAAAACGGAAAAAGCCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTGAGTGGTATTCTTTGGCCTGCTTGTGTCTTTGCAGGTGCGGGAGGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 3091273 3097207 3 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 709 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_525250	7.2e-190	99.9	ProSAPiP1 prote...	Pan troglodytes
XP_001115087	1.5e-189	99.6	ProSAPiP1 prote...	Macaca mulatta
XP_542921	4.6e-186	97.6	similar to ProS...	Canis lupus fam...
CAM13273	7.9e-183	94.4	ProSAPiP1 prote...	Mus musculus
EDL80205	7.4e-181	93.5	ProSAPiP1 prote...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058716	2.5e-22	38.9	KIAA1813
AB002339	1.5e-07	31.8	KIAA0341

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009638 474 675 PF06818 Fez1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009638	474	675	PF06818	Fez1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGTTCTAGGGCAGGTACAGTG

Primer_r
: TGTGTGGCCTCTAACCCTCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTTCTAGGGCAGGTACAGTG
Primer_r	: TGTGTGGCCTCTAACCCTCTG
PCR product length	: 164 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1827 bp
Genome contig ID	gi51511747r_2991273
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTCCTTTCCCAAAGAAATAAAACGGAAAAAGCCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTGAGTGGTATTCTTTGGCCTGCTTGTGTCTTTGCAGGTGCGGGAGGTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	3091273	3097207	3	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0552

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information