HUGE

Gene/Protein Characteristic Table for KIAA1813

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00925
Accession No. :	AB058716
Description :	Leucine zipper putative tumor suppressor 2.
HUGO Gene Name :	leucine zipper, putative tumor suppressor 2 (LZTS2)
Clone Name :	ph00819b [Vector Info]
Flexi ORF Clone :	pF1KSDA1813
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 5733 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 660 bp

Genome contig ID gi89161187f_102649223
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ACCCAAAGAAAAAATTAAAAAAAATTTTTTTGTTT
Flanking genome sequence
(108354 - 108403)
----+----*----+----*----+----*----+----*----+----*
AAAAATAATGTGAATGTGCTGGATAAAGAGTACAGGAACTTGTTTGACCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 102749223 102757575 4 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 673 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BRK4	3.5e-180	100.0	Leucine zipper ...	Homo sapiens
AAH58938	5.1e-180	99.9	LZTS2 protein [...	Homo sapiens
XP_001109715	3.7e-178	99.0	similar to leuc...	Macaca mulatta
AAK31577	2.5e-173	100.0	LAPSER1 [Homo s...	Homo sapiens
XP_001500106	1.7e-171	95.1	leucine zipper,...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011124	2.7e-19	38.9	KIAA0552
AB002339	0.001	32.4	KIAA0341

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009638 443 641 PF06818 Fez1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009638	443	641	PF06818	Fez1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAGCTTCACCTACATCAATG

Primer_r
: AGACAGGGATGAGCTTTGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	660 bp
Genome contig ID	gi89161187f_102649223
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACCCAAAGAAAAAATTAAAAAAAATTTTTTTGTTT
Flanking genome sequence (108354 - 108403)	----+--------+--------+--------+--------+----* AAAAATAATGTGAATGTGCTGGATAAAGAGTACAGGAACTTGTTTGACCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	102749223	102757575	4	99.2	Perfect prediction

Primer_f	: CCAGCTTCACCTACATCAATG
Primer_r	: AGACAGGGATGAGCTTTGGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1813

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information