HUGE

Gene/Protein Characteristic Table for KIAA0352

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00512
Accession No. :	AB002350
Description :	Zinc finger and BTB domain-containing protein 39.
HUGO Gene Name :	zinc finger and BTB domain containing 39 (ZBTB39)
Clone Name :	hg01642 [Vector Info]
Flexi ORF Clone :	pF1KSDA0352
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6170 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3945 bp

Genome contig ID gi89161190r_55578905
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GTTTTTATTTAGAATAAAAAAAGAAATTTGAAATG
Flanking genome sequence
(99980 - 99931)
----+----*----+----*----+----*----+----*----+----*
AGAGTTCTCTTCCTACCTACTATGAATATGCTCATACCTGGAGTTCAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 55678885 55686497 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 721 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15060	100.0	Zinc finger and...	Homo sapiens
XP_522441	99.2	zinc finger and...	Pan troglodytes
XP_001115523	97.6	zinc finger and...	Macaca mulatta
XP_001488157	93.5	similar to Zinc...	Equus caballus
EDL24521	88.9	zinc finger and...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075834	2.2e-08	27.7	KIAA1954
AB037809	4.3e-07	26.6	KIAA1388
AB058730	7.1e-05	26.8	KIAA1827
AB051490	8.4e-05	23.7	KIAA1703
AB023178	0.00012	27.5	KIAA0961

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 29 135 PF00651 BTB/POZ

IPR007087 517 539 PF00096 Zinc finger

IPR007087 614 636 PF00096 Zinc finger

IPR007087 642 664 PF00096 Zinc finger

HMMSmart IPR000210 39 135 SM00225 BTB/POZ-like

IPR015880 381 403 SM00355 Zinc finger

IPR015880 409 429 SM00355 Zinc finger

IPR015880 460 483 SM00355 Zinc finger

IPR015880 489 511 SM00355 Zinc finger

IPR015880 517 539 SM00355 Zinc finger

IPR015880 547 569 SM00355 Zinc finger

IPR015880 614 636 SM00355 Zinc finger

IPR015880 642 664 SM00355 Zinc finger

IPR015880 670 692 SM00355 Zinc finger

ProfileScan IPR000210 39 105 PS50097 BTB/POZ-like

IPR007087 517 544 PS50157 Zinc finger

IPR007087 547 569 PS50157 Zinc finger

IPR007087 614 641 PS50157 Zinc finger

IPR007087 642 669 PS50157 Zinc finger

IPR007087 670 697 PS50157 Zinc finger

ScanRegExp IPR007087 383 403 PS00028 Zinc finger

IPR007087 519 539 PS00028 Zinc finger

IPR007087 549 569 PS00028 Zinc finger

IPR007087 616 636 PS00028 Zinc finger

IPR007087 644 664 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	29	135	PF00651	BTB/POZ
IPR007087	517	539	PF00096	Zinc finger
IPR007087	614	636	PF00096	Zinc finger
IPR007087	642	664	PF00096	Zinc finger
HMMSmart	IPR000210	39	135	SM00225	BTB/POZ-like
IPR015880	381	403	SM00355	Zinc finger
IPR015880	409	429	SM00355	Zinc finger
IPR015880	460	483	SM00355	Zinc finger
IPR015880	489	511	SM00355	Zinc finger
IPR015880	517	539	SM00355	Zinc finger
IPR015880	547	569	SM00355	Zinc finger
IPR015880	614	636	SM00355	Zinc finger
IPR015880	642	664	SM00355	Zinc finger
IPR015880	670	692	SM00355	Zinc finger
ProfileScan	IPR000210	39	105	PS50097	BTB/POZ-like
IPR007087	517	544	PS50157	Zinc finger
IPR007087	547	569	PS50157	Zinc finger
IPR007087	614	641	PS50157	Zinc finger
IPR007087	642	669	PS50157	Zinc finger
IPR007087	670	697	PS50157	Zinc finger
ScanRegExp	IPR007087	383	403	PS00028	Zinc finger
IPR007087	519	539	PS00028	Zinc finger
IPR007087	549	569	PS00028	Zinc finger
IPR007087	616	636	PS00028	Zinc finger
IPR007087	644	664	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAGGTAATTTCATAGGAGCTG

Primer_r
: ACGTCGCACATGGTCTCTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGGTAATTTCATAGGAGCTG
Primer_r	: ACGTCGCACATGGTCTCTGAG
PCR product length	: 121 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3945 bp
Genome contig ID	gi89161190r_55578905
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTTTTTATTTAGAATAAAAAAAGAAATTTGAAATG
Flanking genome sequence (99980 - 99931)	----+--------+--------+--------+--------+----* AGAGTTCTCTTCCTACCTACTATGAATATGCTCATACCTGGAGTTCAGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	55678885	55686497	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0352

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information