HUGE

Gene/Protein Characteristic Table for KIAA1703

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05704
Accession No. :	AB051490
Description :
HUGO Gene Name :	zinc finger protein 407 (ZNF407)
Clone Name :	fj16891 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4701 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1201 bp

Genome contig ID gi51511735f_70375211
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTGTTTTCTTTGAAATAAAATTATAACGTTAAAAG
Flanking genome sequence
(531404 - 531453)
----+----*----+----*----+----*----+----*----+----*
ATCACGATGGCATGTTATTTTCAGCAGCCAGTGGTGGGCAGCTGTGGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 70475211 70906613 8 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0G0	100.0	Zinc finger pro...	Homo sapiens
XP_001085704	97.4	zinc finger pro...	Macaca mulatta
XP_523972	99.4	hypothetical pr...	Pan troglodytes
XP_225679	81.4	similar to Zinc...	Rattus norvegicus
EDL75191	81.4	similar to zinc...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095928	1.2e-23	28.6	KIAA2007
AB046831	1.8e-23	32.1	KIAA1611
AB040906	1.5e-22	30.8	KIAA1473
AB037770	1.8e-22	32.3	KIAA1349
AB037852	4.2e-22	28.0	KIAA1431

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 361 385 PF00096 Zinc finger

IPR007087 403 426 PF00096 Zinc finger

IPR007087 484 506 PF00096 Zinc finger

IPR007087 512 535 PF00096 Zinc finger

IPR007087 545 567 PF00096 Zinc finger

IPR007087 573 597 PF00096 Zinc finger

IPR007087 631 653 PF00096 Zinc finger

IPR007087 690 713 PF00096 Zinc finger

HMMSmart IPR015880 331 354 SM00355 Zinc finger

IPR015880 361 385 SM00355 Zinc finger

IPR015880 403 426 SM00355 Zinc finger

IPR015880 454 478 SM00355 Zinc finger

IPR015880 484 506 SM00355 Zinc finger

IPR015880 512 535 SM00355 Zinc finger

IPR015880 545 567 SM00355 Zinc finger

IPR015880 573 597 SM00355 Zinc finger

IPR015880 603 625 SM00355 Zinc finger

IPR015880 631 653 SM00355 Zinc finger

IPR015880 659 684 SM00355 Zinc finger

IPR015880 690 713 SM00355 Zinc finger

ProfileScan IPR007087 361 390 PS50157 Zinc finger

IPR007087 403 426 PS50157 Zinc finger

IPR007087 512 540 PS50157 Zinc finger

IPR007087 545 572 PS50157 Zinc finger

IPR007087 573 602 PS50157 Zinc finger

IPR007087 603 630 PS50157 Zinc finger

IPR007087 631 658 PS50157 Zinc finger

ScanRegExp IPR007087 363 385 PS00028 Zinc finger

IPR007087 405 426 PS00028 Zinc finger

IPR007087 514 535 PS00028 Zinc finger

IPR007087 547 567 PS00028 Zinc finger

IPR007087 575 597 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	361	385	PF00096	Zinc finger
IPR007087	403	426	PF00096	Zinc finger
IPR007087	484	506	PF00096	Zinc finger
IPR007087	512	535	PF00096	Zinc finger
IPR007087	545	567	PF00096	Zinc finger
IPR007087	573	597	PF00096	Zinc finger
IPR007087	631	653	PF00096	Zinc finger
IPR007087	690	713	PF00096	Zinc finger
HMMSmart	IPR015880	331	354	SM00355	Zinc finger
IPR015880	361	385	SM00355	Zinc finger
IPR015880	403	426	SM00355	Zinc finger
IPR015880	454	478	SM00355	Zinc finger
IPR015880	484	506	SM00355	Zinc finger
IPR015880	512	535	SM00355	Zinc finger
IPR015880	545	567	SM00355	Zinc finger
IPR015880	573	597	SM00355	Zinc finger
IPR015880	603	625	SM00355	Zinc finger
IPR015880	631	653	SM00355	Zinc finger
IPR015880	659	684	SM00355	Zinc finger
IPR015880	690	713	SM00355	Zinc finger
ProfileScan	IPR007087	361	390	PS50157	Zinc finger
IPR007087	403	426	PS50157	Zinc finger
IPR007087	512	540	PS50157	Zinc finger
IPR007087	545	572	PS50157	Zinc finger
IPR007087	573	602	PS50157	Zinc finger
IPR007087	603	630	PS50157	Zinc finger
IPR007087	631	658	PS50157	Zinc finger
ScanRegExp	IPR007087	363	385	PS00028	Zinc finger
IPR007087	405	426	PS00028	Zinc finger
IPR007087	514	535	PS00028	Zinc finger
IPR007087	547	567	PS00028	Zinc finger
IPR007087	575	597	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGGACTGAGTGGACTGAATG

Primer_r
: ACACTGGCCTGCTCATTTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: CCR
Primer_f	: AGGGTGCCCAGATCATCATGC
Primer_r	: AGCTCTGTCAGGATGTAGTGC
PCR product length	: 169 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1201 bp
Genome contig ID	gi51511735f_70375211
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTGTTTTCTTTGAAATAAAATTATAACGTTAAAAG
Flanking genome sequence (531404 - 531453)	----+--------+--------+--------+--------+----* ATCACGATGGCATGTTATTTTCAGCAGCCAGTGGTGGGCAGCTGTGGCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	70475211	70906613	8	99.2	Perfect prediction

Primer_f	: ATGGACTGAGTGGACTGAATG
Primer_r	: ACACTGGCCTGCTCATTTCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1703

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information