HUGE

Gene/Protein Characteristic Table for KIAA1473

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00846
Accession No. :	AB040906
Description :	Zinc finger protein 492.
HUGO Gene Name :	zinc finger protein 492 (ZNF492)
Clone Name :	fj03262 [Vector Info]
Flexi ORF Clone :	pF1KSDA1473
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4133 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2406 bp

Genome contig ID gi42406306f_22509079
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTCTGAGTCCTGAATAAATAAAAATAATTTCTTGT
Flanking genome sequence
(133235 - 133284)
----+----*----+----*----+----*----+----*----+----*
ATATTTTTCTTTGAATATGTGGCCTCTCTACTTGCAAACAGATACAGGCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 22609079 22642312 4 99.1 Perfect prediction

ContigView(URL based/DAS) 19 r 22363750 22396874 4 97.0 Perfect prediction

Features of the protein sequence	Description

Length: 574 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001092096	97.5	zinc finger pro...	Homo sapiens
Q9P255	100.0	Zinc finger pro...	Homo sapiens
EAW84926	99.4	hCG1780278 [Hom...	Homo sapiens
A6NK75	97.9	Zinc finger pro...	Homo sapiens
AAI10577	97.7	ZNF98 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075849	3.7e-120	74.0	KIAA1969
AB046831	9.8e-79	48.1	KIAA1611
AB046779	1.6e-77	50.5	KIAA1559
AB075862	7.3e-75	51.2	KIAA1982
AB058730	1.5e-71	53.9	KIAA1827

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 212 235 PD000003 Zinc finger

IPR007087 240 263 PD000003 Zinc finger

IPR007087 268 291 PD000003 Zinc finger

IPR007087 296 318 PD000003 Zinc finger

IPR007087 324 347 PD000003 Zinc finger

IPR007087 352 375 PD000003 Zinc finger

IPR007087 380 403 PD000003 Zinc finger

IPR007087 408 431 PD000003 Zinc finger

IPR007087 436 459 PD000003 Zinc finger

IPR007087 464 487 PD000003 Zinc finger

IPR007087 492 515 PD000003 Zinc finger

IPR007087 520 543 PD000003 Zinc finger

HMMPfam IPR001909 15 55 PF01352 KRAB box

IPR007087 184 206 PF00096 Zinc finger

IPR007087 212 234 PF00096 Zinc finger

IPR007087 240 262 PF00096 Zinc finger

IPR007087 268 290 PF00096 Zinc finger

IPR007087 296 318 PF00096 Zinc finger

IPR007087 324 346 PF00096 Zinc finger

IPR007087 352 374 PF00096 Zinc finger

IPR007087 380 402 PF00096 Zinc finger

IPR007087 408 430 PF00096 Zinc finger

IPR007087 436 458 PF00096 Zinc finger

IPR007087 464 486 PF00096 Zinc finger

IPR007087 492 514 PF00096 Zinc finger

IPR007087 520 542 PF00096 Zinc finger

HMMSmart IPR001909 15 75 SM00349 KRAB box

IPR015880 184 206 SM00355 Zinc finger

IPR015880 212 234 SM00355 Zinc finger

IPR015880 240 262 SM00355 Zinc finger

IPR015880 268 290 SM00355 Zinc finger

IPR015880 296 318 SM00355 Zinc finger

IPR015880 324 346 SM00355 Zinc finger

IPR015880 352 374 SM00355 Zinc finger

IPR015880 380 402 SM00355 Zinc finger

IPR015880 408 430 SM00355 Zinc finger

IPR015880 436 458 SM00355 Zinc finger

IPR015880 464 486 SM00355 Zinc finger

IPR015880 492 514 SM00355 Zinc finger

IPR015880 520 542 SM00355 Zinc finger

ProfileScan IPR001909 15 86 PS50805 KRAB box

IPR007087 184 211 PS50157 Zinc finger

IPR007087 212 239 PS50157 Zinc finger

IPR007087 240 267 PS50157 Zinc finger

IPR007087 268 295 PS50157 Zinc finger

IPR007087 296 323 PS50157 Zinc finger

IPR007087 324 351 PS50157 Zinc finger

IPR007087 352 379 PS50157 Zinc finger

IPR007087 380 407 PS50157 Zinc finger

IPR007087 408 435 PS50157 Zinc finger

IPR007087 436 463 PS50157 Zinc finger

IPR007087 464 491 PS50157 Zinc finger

IPR007087 492 519 PS50157 Zinc finger

IPR007087 520 547 PS50157 Zinc finger

ScanRegExp IPR007087 186 206 PS00028 Zinc finger

IPR007087 214 234 PS00028 Zinc finger

IPR007087 242 262 PS00028 Zinc finger

IPR007087 270 290 PS00028 Zinc finger

IPR007087 298 318 PS00028 Zinc finger

IPR007087 326 346 PS00028 Zinc finger

IPR007087 354 374 PS00028 Zinc finger

IPR007087 382 402 PS00028 Zinc finger

IPR007087 410 430 PS00028 Zinc finger

IPR007087 438 458 PS00028 Zinc finger

IPR007087 466 486 PS00028 Zinc finger

IPR007087 522 542 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	212	235	PD000003	Zinc finger
IPR007087	240	263	PD000003	Zinc finger
IPR007087	268	291	PD000003	Zinc finger
IPR007087	296	318	PD000003	Zinc finger
IPR007087	324	347	PD000003	Zinc finger
IPR007087	352	375	PD000003	Zinc finger
IPR007087	380	403	PD000003	Zinc finger
IPR007087	408	431	PD000003	Zinc finger
IPR007087	436	459	PD000003	Zinc finger
IPR007087	464	487	PD000003	Zinc finger
IPR007087	492	515	PD000003	Zinc finger
IPR007087	520	543	PD000003	Zinc finger
HMMPfam	IPR001909	15	55	PF01352	KRAB box
IPR007087	184	206	PF00096	Zinc finger
IPR007087	212	234	PF00096	Zinc finger
IPR007087	240	262	PF00096	Zinc finger
IPR007087	268	290	PF00096	Zinc finger
IPR007087	296	318	PF00096	Zinc finger
IPR007087	324	346	PF00096	Zinc finger
IPR007087	352	374	PF00096	Zinc finger
IPR007087	380	402	PF00096	Zinc finger
IPR007087	408	430	PF00096	Zinc finger
IPR007087	436	458	PF00096	Zinc finger
IPR007087	464	486	PF00096	Zinc finger
IPR007087	492	514	PF00096	Zinc finger
IPR007087	520	542	PF00096	Zinc finger
HMMSmart	IPR001909	15	75	SM00349	KRAB box
IPR015880	184	206	SM00355	Zinc finger
IPR015880	212	234	SM00355	Zinc finger
IPR015880	240	262	SM00355	Zinc finger
IPR015880	268	290	SM00355	Zinc finger
IPR015880	296	318	SM00355	Zinc finger
IPR015880	324	346	SM00355	Zinc finger
IPR015880	352	374	SM00355	Zinc finger
IPR015880	380	402	SM00355	Zinc finger
IPR015880	408	430	SM00355	Zinc finger
IPR015880	436	458	SM00355	Zinc finger
IPR015880	464	486	SM00355	Zinc finger
IPR015880	492	514	SM00355	Zinc finger
IPR015880	520	542	SM00355	Zinc finger
ProfileScan	IPR001909	15	86	PS50805	KRAB box
IPR007087	184	211	PS50157	Zinc finger
IPR007087	212	239	PS50157	Zinc finger
IPR007087	240	267	PS50157	Zinc finger
IPR007087	268	295	PS50157	Zinc finger
IPR007087	296	323	PS50157	Zinc finger
IPR007087	324	351	PS50157	Zinc finger
IPR007087	352	379	PS50157	Zinc finger
IPR007087	380	407	PS50157	Zinc finger
IPR007087	408	435	PS50157	Zinc finger
IPR007087	436	463	PS50157	Zinc finger
IPR007087	464	491	PS50157	Zinc finger
IPR007087	492	519	PS50157	Zinc finger
IPR007087	520	547	PS50157	Zinc finger
ScanRegExp	IPR007087	186	206	PS00028	Zinc finger
IPR007087	214	234	PS00028	Zinc finger
IPR007087	242	262	PS00028	Zinc finger
IPR007087	270	290	PS00028	Zinc finger
IPR007087	298	318	PS00028	Zinc finger
IPR007087	326	346	PS00028	Zinc finger
IPR007087	354	374	PS00028	Zinc finger
IPR007087	382	402	PS00028	Zinc finger
IPR007087	410	430	PS00028	Zinc finger
IPR007087	438	458	PS00028	Zinc finger
IPR007087	466	486	PS00028	Zinc finger
IPR007087	522	542	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAAGCCTAGAAACGGGAGTG

Primer_r
: GCAATACCCACGAAGACCAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: CCR
Primer_f	: GCATGAGGTAGGTGTTCTGAG
Primer_r	: CCTTTTACCTACACCCTTGAG
PCR product length	: 266 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2406 bp
Genome contig ID	gi42406306f_22509079
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTCTGAGTCCTGAATAAATAAAAATAATTTCTTGT
Flanking genome sequence (133235 - 133284)	----+--------+--------+--------+--------+----* ATATTTTTCTTTGAATATGTGGCCTCTCTACTTGCAAACAGATACAGGCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	22609079	22642312	4	99.1	Perfect prediction
ContigView(URL based/DAS)	19	r	22363750	22396874	4	97.0	Perfect prediction

Primer_f	: GGAAGCCTAGAAACGGGAGTG
Primer_r	: GCAATACCCACGAAGACCAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1473

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information