| HUGE |
Gene/Protein Characteristic Table for KIAA0474 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00086 |
|---|---|
| Accession No. : | AB007943 |
| Description : | Rap1 GTPase-activating protein 1. |
| HUGO Gene Name : | RAP1 GTPase activating protein (RAP1GAP) |
| Clone Name : | fj12051 [Vector Info] |
| Flexi ORF Clone : | pF1KA0474
![]() |
| Source : | Human fetal brain |
| Note : | We replaced hh00401 and fj22150, former representative clones for KIAA0474 with fj12051. (2003/8/28,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3426 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1077 bp Genome contig ID gi89161185r_21695302 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
AGTTGTATAAAATAAATTCTATTTATCGCTATTGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACCCAGAGTTGGGCCTGGCTTTGTGTGAACCGTGGCCAGATTGACCCCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 21795302 21868381 27 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 782 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : |
| : | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |