HUGE

Gene/Protein Characteristic Table for KIAA0474

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00086
Accession No. :	AB007943
Description :	Rap1 GTPase-activating protein 1.
HUGO Gene Name :	RAP1 GTPase activating protein (RAP1GAP)
Clone Name :	fj12051 [Vector Info]
Flexi ORF Clone :	pF1KA0474
Source :	Human fetal brain
Note :	We replaced hh00401 and fj22150, former representative clones for KIAA0474 with fj12051. (2003/8/28,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 3426 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1077 bp

Genome contig ID gi89161185r_21695302
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AGTTGTATAAAATAAATTCTATTTATCGCTATTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCCAGAGTTGGGCCTGGCTTTGTGTGAACCGTGGCCAGATTGACCCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 21795302 21868381 27 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 782 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001109771	93.9	RAP1, GTPase ac...	Macaca mulatta
XP_233609	93.6	similar to Rap1...	Rattus norvegicus
BAG10342	100.0	Rap1 GTPase-act...	synthetic construct
EAW94979	98.8	RAP1, GTPase ac...	Homo sapiens
CAH91457	93.4	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028962	1.9e-49	54.9	KIAA1039
AB007900	2.1e-25	39.8	KIAA0440
AB037810	3.9e-25	36.8	KIAA1389
AB011117	5.6e-25	37.4	KIAA0545
AB033098	6.3e-08	28.5	KIAA1272

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003109 96 118 PF02188 GoLoco

IPR000331 311 498 PF02145 Rap/ran-GAP

HMMSmart IPR003109 96 118 SM00390 GoLoco

ProfileScan IPR003109 96 118 PS50877 GoLoco

IPR000331 282 498 PS50085 Rap/ran-GAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003109	96	118	PF02188	GoLoco
IPR000331	311	498	PF02145	Rap/ran-GAP
HMMSmart	IPR003109	96	118	SM00390	GoLoco
ProfileScan	IPR003109	96	118	PS50877	GoLoco
IPR000331	282	498	PS50085	Rap/ran-GAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

Experimental conditions

Panel name	:
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1077 bp
Genome contig ID	gi89161185r_21695302
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AGTTGTATAAAATAAATTCTATTTATCGCTATTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCAGAGTTGGGCCTGGCTTTGTGTGAACCGTGGCCAGATTGACCCCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	21795302	21868381	27	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0474

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information