HUGE

Gene/Protein Characteristic Table for KIAA1389

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06831
Accession No. :	AB037810
Description :	Signal-induced proliferation-associated 1-like protein 2.
HUGO Gene Name :	signal-induced proliferation-associated 1 like 2 (SIPA1L2)
Clone Name :	hh03860 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5801 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1159 bp

Genome contig ID gi89161185r_230500337
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TTTTTTAATAAATGTTTAAAAGAAGTCCACATAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGGTGTTGTCAGGTGACTAGATTTTTTGTGATCTAACATGTCAACAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 230600337 230717112 22 99.9 Internal No-hit

Features of the protein sequence	Description

Length: 1514 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO12530	99.9	SPA-1-like 2 [H...	Homo sapiens
Q9P2F8	99.8	Signal-induced ...	Homo sapiens
XP_001151957	99.6	signal-induced ...	Pan troglodytes
AAI50335	100.0	SIPA1L2 protein...	Homo sapiens
XP_001493812	95.7	similar to SPA-...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007900	7.1e-154	54.3	KIAA0440
AB011117	2.2e-119	50.4	KIAA0545
AB007943	2e-22	36.8	KIAA0474
AB028962	1.8e-19	49.7	KIAA1039
AB033098	7.6e-05	29.2	KIAA1272

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000331 416 604 PF02145 Rap/ran-GAP

IPR001478 742 814 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 751 817 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000331 387 604 PS50085 Rap/ran-GAP

IPR001478 742 818 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	416	604	PF02145	Rap/ran-GAP
IPR001478	742	814	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	751	817	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000331	387	604	PS50085	Rap/ran-GAP
IPR001478	742	818	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCCAGCGGAACCACTTGTAC

Primer_r
: CATCGTAGTGCAGGCCAAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1159 bp
Genome contig ID	gi89161185r_230500337
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTTTTTAATAAATGTTTAAAAGAAGTCCACATAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGGTGTTGTCAGGTGACTAGATTTTTTGTGATCTAACATGTCAACAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	230600337	230717112	22	99.9	Internal No-hit

Primer_f	: AGCCAGCGGAACCACTTGTAC
Primer_r	: CATCGTAGTGCAGGCCAAACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1389

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information