HUGE

Gene/Protein Characteristic Table for KIAA0545

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06832
Accession No. :	AB011117
Description :	Signal-induced proliferation-associated 1-like protein 3.
HUGO Gene Name :	signal-induced proliferation-associated 1 like 3 (SIPA1L3)
Clone Name :	hh00165s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh00165, former representative clones for KIAA0545 with hh00165s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6237 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2129 bp

Genome contig ID gi42406306f_43165284
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TTCTGGAGGTTTCAAAGGAAATAAATGTTTCATAG
Flanking genome sequence
(225564 - 225613)
----+----*----+----*----+----*----+----*----+----*
AAATGGCTTGTGTGTTCACTTTTGGGGCAGCTGCCTGGAGTTGCTGACCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 43265284 43390846 20 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1368 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60292	100.0	Signal-induced ...	Homo sapiens
AAI50621	100.0	Signal-induced ...	Homo sapiens
XP_524247	99.3	signal-induced ...	Pan troglodytes
XP_855409	93.9	similar to sign...	Canis lupus fam...
EDL24066	93.4	mCG122846 [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007900	5.1e-81	51.2	KIAA0440
AB037810	4.1e-80	50.2	KIAA1389
AB007943	3.2e-14	37.5	KIAA0474
AB028962	2.8e-12	49.7	KIAA1039

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000331 227 415 PF02145 Rap/ran-GAP

IPR001478 553 625 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 562 628 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000331 198 415 PS50085 Rap/ran-GAP

IPR001478 553 617 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	227	415	PF02145	Rap/ran-GAP
IPR001478	553	625	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	562	628	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000331	198	415	PS50085	Rap/ran-GAP
IPR001478	553	617	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CAGTTGTCTCCTCCCATCTTC

Primer_r
: GCTGCTATCTTCGGCCATTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGTTGTCTCCTCCCATCTTC
Primer_r	: GCTGCTATCTTCGGCCATTGG
PCR product length	: 177 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2129 bp
Genome contig ID	gi42406306f_43165284
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTCTGGAGGTTTCAAAGGAAATAAATGTTTCATAG
Flanking genome sequence (225564 - 225613)	----+--------+--------+--------+--------+----* AAATGGCTTGTGTGTTCACTTTTGGGGCAGCTGCCTGGAGTTGCTGACCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	43265284	43390846	20	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0545

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information