HUGE |
Gene/Protein Characteristic Table for KIAA0581 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01979 |
---|---|
Accession No. : | AB011153 |
Description : | 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta 1. |
HUGO Gene Name : | phospholipase C, beta 1 (phosphoinositide-specific) (PLCB1) |
Clone Name : | pf10976 [Vector Info] |
Flexi ORF Clone : | pF1KA0581
![]() |
Source : | Human brain (hippocampus) |
Note : | We replaced hj00610 and hj00610s1, former representative clones for KIAA0581 with pf10976. (2002/5/10,2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7092 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3054 bp Genome contig ID gi51511747f_7960912 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
CCAAAGGAAAGAATAAAAATTTCTTAACACAACCCFlanking genome sequence
(852640 - 852689) ----+----*----+----*----+----*----+----*----+----*
AGCGGTTATTTCTTGGGGTCAGAGTCAACCTTCTTTTGACAGGGAAAGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 8060912 8813550 32 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1218 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TGATGGATTGGACGTTGTGAC | |
: CAAGTGGAAGAAACATCATGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: GeneBridge 4 | |
: AGGGCCATTTGCTTGCATTAC | |
: TCACAACGTCCAATCCATCAC | |
: 85 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |