HUGE

Gene/Protein Characteristic Table for KIAA0450

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK06389
Accession No. :	AB007919
Description :	1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase eta 2 (Fragment).
HUGO Gene Name :	phospholipase C, eta 2 (PLCH2)
Clone Name :	hj05822 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg00217, former representative clones for KIAA0450 with hj05822. (2004/1/10)

Features of the cloned DNA sequence	Description

Length: 5450 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1899 bp

Genome contig ID gi89161185f_2288758
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
AAAACTTATACAACATTAAAATGATACCAAGTCCC
Flanking genome sequence
(138069 - 138118)
----+----*----+----*----+----*----+----*----+----*
TTTCCATTTTTACCTGGTTTTTCACCCCAGGTGTGTGTGGTGTGCATCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 2388758 2426825 22 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1182 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001085197	95.0	phospholipase C...	Macaca mulatta
BAC56930	99.7	FLJ00414 protei...	Homo sapiens
CAX30816	100.0	phospholipase C...	Homo sapiens
O75038	90.5	1-phosphatidyli...	Homo sapiens
EAW56101	100.0	phospholipase C...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028992	7.8e-80	61.5	KIAA1069
AB029015	2.6e-33	37.0	KIAA1092
AB075844	5.2e-27	35.6	KIAA1964
AB011153	2e-13	30.4	KIAA0581
AB040949	5.5e-13	32.5	KIAA1516

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 200 264 PD000012 Calcium-binding EF-hand

IPR013841 363 512 PD001202 Phosphatidylinositol-specific phospholipase C

IPR013841 623 772 PD001202 Phosphatidylinositol-specific phospholipase C

FPrintScan IPR001192 357 375 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 383 403 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 481 498 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 704 725 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 725 743 PR00390 Phosphoinositide-specific phospholipase C

IPR000008 807 819 PR00360 C2 calcium-dependent membrane targeting

IPR000008 837 850 PR00360 C2 calcium-dependent membrane targeting

IPR000008 859 867 PR00360 C2 calcium-dependent membrane targeting

IPR001192 879 889 PR00390 Phosphoinositide-specific phospholipase C

HMMPfam IPR001849 74 181 PF00169 Pleckstrin-like

IPR002048 199 227 PF00036 Calcium-binding EF-hand

IPR002048 247 264 PF00036 Calcium-binding EF-hand

IPR015359 269 351 PF09279 EF-hand-like

IPR000909 353 498 PF00388 Phosphatidylinositol-specific phospholipase C

IPR001711 651 766 PF00387 Phosphatidylinositol-specific phospholipase C

IPR000008 786 878 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR001849 74 183 SM00233 Pleckstrin-like

IPR002048 199 227 SM00054 Calcium-binding EF-hand

IPR002048 235 264 SM00054 Calcium-binding EF-hand

IPR000909 352 497 SM00148 Phosphatidylinositol-specific phospholipase C

IPR001711 652 766 SM00149 Phosphatidylinositol-specific phospholipase C

IPR000008 785 893 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR001849 73 181 PS50003 Pleckstrin-like

IPR002048 195 230 PS50222 Calcium-binding EF-hand

IPR002048 231 267 PS50222 Calcium-binding EF-hand

IPR000909 352 497 PS50007 Phosphatidylinositol-specific phospholipase C

IPR001711 652 765 PS50008 Phosphatidylinositol-specific phospholipase C

IPR000008 771 878 PS50004 C2 calcium-dependent membrane targeting

ScanRegExp IPR002048 208 220 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	200	264	PD000012	Calcium-binding EF-hand
IPR013841	363	512	PD001202	Phosphatidylinositol-specific phospholipase C
IPR013841	623	772	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	357	375	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	383	403	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	481	498	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	704	725	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	725	743	PR00390	Phosphoinositide-specific phospholipase C
IPR000008	807	819	PR00360	C2 calcium-dependent membrane targeting
IPR000008	837	850	PR00360	C2 calcium-dependent membrane targeting
IPR000008	859	867	PR00360	C2 calcium-dependent membrane targeting
IPR001192	879	889	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR001849	74	181	PF00169	Pleckstrin-like
IPR002048	199	227	PF00036	Calcium-binding EF-hand
IPR002048	247	264	PF00036	Calcium-binding EF-hand
IPR015359	269	351	PF09279	EF-hand-like
IPR000909	353	498	PF00388	Phosphatidylinositol-specific phospholipase C
IPR001711	651	766	PF00387	Phosphatidylinositol-specific phospholipase C
IPR000008	786	878	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001849	74	183	SM00233	Pleckstrin-like
IPR002048	199	227	SM00054	Calcium-binding EF-hand
IPR002048	235	264	SM00054	Calcium-binding EF-hand
IPR000909	352	497	SM00148	Phosphatidylinositol-specific phospholipase C
IPR001711	652	766	SM00149	Phosphatidylinositol-specific phospholipase C
IPR000008	785	893	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR001849	73	181	PS50003	Pleckstrin-like
IPR002048	195	230	PS50222	Calcium-binding EF-hand
IPR002048	231	267	PS50222	Calcium-binding EF-hand
IPR000909	352	497	PS50007	Phosphatidylinositol-specific phospholipase C
IPR001711	652	765	PS50008	Phosphatidylinositol-specific phospholipase C
IPR000008	771	878	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR002048	208	220	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCCAGCAGCTTTAGCCTTTCC
Primer_r	: TGGGCGTGTTGTTTGCTCAGG
PCR product length	: 133 bp
PCR conditions	: 95 °C15 sec66 °C60 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1899 bp
Genome contig ID	gi89161185f_2288758
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AAAACTTATACAACATTAAAATGATACCAAGTCCC
Flanking genome sequence (138069 - 138118)	----+--------+--------+--------+--------+----* TTTCCATTTTTACCTGGTTTTTCACCCCAGGTGTGTGTGGTGTGCATCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	2388758	2426825	22	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0450

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information