HUGE

Gene/Protein Characteristic Table for KIAA1964

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06387
Accession No. :	AB075844
Description :	phospholipase C delta 3.
HUGO Gene Name :
Clone Name :	ph00746 [Vector Info]
Flexi ORF Clone :	pF1KA1964
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 5926 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3651 bp

Genome contig ID gi51511734r_40441861
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTCTTTATTAGAAACAAGTGAGATGTATTGAGCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACAACAATGCATTTGGTATTTCCTCCCCGACCCTGGAAATGGATGCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 40541861 40565208 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 757 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N3E9	100.0	1-phosphatidyli...	Homo sapiens
CAD39054	99.9	hypothetical pr...	Homo sapiens
XP_001115230	98.3	similar to phos...	Macaca mulatta
XP_001142960	95.5	phospholipase C...	Pan troglodytes
XP_001917291	93.3	similar to 1-ph...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029015	3.8e-60	37.2	KIAA1092
AB007919	9.1e-42	35.6	KIAA0450
AB028992	3.7e-28	35.0	KIAA1069
AB040949	1.1e-20	30.5	KIAA1516
AB011153	5.2e-17	30.6	KIAA0581

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR013841 316 600 PD001202 Phosphatidylinositol-specific phospholipase C

FPrintScan IPR001192 310 328 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 336 356 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 434 451 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 550 571 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 571 589 PR00390 Phosphoinositide-specific phospholipase C

IPR000008 648 660 PR00360 C2 calcium-dependent membrane targeting

IPR000008 678 691 PR00360 C2 calcium-dependent membrane targeting

IPR000008 700 708 PR00360 C2 calcium-dependent membrane targeting

IPR001192 721 731 PR00390 Phosphoinositide-specific phospholipase C

HMMPfam IPR015359 223 304 PF09279 EF-hand-like

IPR000909 306 451 PF00388 Phosphatidylinositol-specific phospholipase C

IPR001711 495 612 PF00387 Phosphatidylinositol-specific phospholipase C

IPR000008 630 720 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR001849 33 142 SM00233 Pleckstrin-like

IPR000909 305 450 SM00148 Phosphatidylinositol-specific phospholipase C

IPR001711 496 612 SM00149 Phosphatidylinositol-specific phospholipase C

IPR000008 629 735 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000909 305 450 PS50007 Phosphatidylinositol-specific phospholipase C

IPR001711 496 612 PS50008 Phosphatidylinositol-specific phospholipase C

IPR000008 615 720 PS50004 C2 calcium-dependent membrane targeting

ScanRegExp IPR002048 199 211 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	316	600	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	310	328	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	336	356	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	434	451	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	550	571	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	571	589	PR00390	Phosphoinositide-specific phospholipase C
IPR000008	648	660	PR00360	C2 calcium-dependent membrane targeting
IPR000008	678	691	PR00360	C2 calcium-dependent membrane targeting
IPR000008	700	708	PR00360	C2 calcium-dependent membrane targeting
IPR001192	721	731	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR015359	223	304	PF09279	EF-hand-like
IPR000909	306	451	PF00388	Phosphatidylinositol-specific phospholipase C
IPR001711	495	612	PF00387	Phosphatidylinositol-specific phospholipase C
IPR000008	630	720	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001849	33	142	SM00233	Pleckstrin-like
IPR000909	305	450	SM00148	Phosphatidylinositol-specific phospholipase C
IPR001711	496	612	SM00149	Phosphatidylinositol-specific phospholipase C
IPR000008	629	735	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000909	305	450	PS50007	Phosphatidylinositol-specific phospholipase C
IPR001711	496	612	PS50008	Phosphatidylinositol-specific phospholipase C
IPR000008	615	720	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR002048	199	211	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGGATGAACTCAGCCAACTAC

Primer_r
: AGGCAGGTTTTAGGACGTAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3651 bp
Genome contig ID	gi51511734r_40441861
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCTTTATTAGAAACAAGTGAGATGTATTGAGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAACAATGCATTTGGTATTTCCTCCCCGACCCTGGAAATGGATGCCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	40541861	40565208	15	99.3	Perfect prediction

Primer_f	: CGGATGAACTCAGCCAACTAC
Primer_r	: AGGCAGGTTTTAGGACGTAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1964

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information