HUGE

Gene/Protein Characteristic Table for KIAA1069

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06388
Accession No. :	AB028992
Description :	phospholipase C-like 3.
HUGO Gene Name :	phospholipase C, eta 1 (PLCH1)
Clone Name :	hj05486 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5551 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3187 bp

Genome contig ID gi89161205r_156580365
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ATTCATGAAAATATAATTAAAACACATTTTTAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTGGTGAACTTTTTTTACAATTGAAATTCATATGATGACTATTGAGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 156680365 156784044 20 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW78749	100.0	phospholipase C...	Homo sapiens
AAW22607	100.0	phospholipase C...	Homo sapiens
Q4KWH8	99.7	1-phosphatidyli...	Homo sapiens
XP_001148875	99.7	phospholipase C...	Pan troglodytes
XP_001149022	99.5	phospholipase C...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007919	2.8e-145	61.5	KIAA0450
AB029015	1.1e-37	37.3	KIAA1092
AB075844	2.4e-34	34.8	KIAA1964
AB040949	8.1e-28	33.6	KIAA1516
AB011153	3.1e-21	30.4	KIAA0581

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR013841 95 364 PD001202 Phosphatidylinositol-specific phospholipase C

IPR013841 380 505 PD001202 Phosphatidylinositol-specific phospholipase C

FPrintScan IPR001192 89 107 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 115 135 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 213 230 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 437 458 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 458 476 PR00390 Phosphoinositide-specific phospholipase C

IPR000008 540 552 PR00360 C2 calcium-dependent membrane targeting

IPR000008 570 583 PR00360 C2 calcium-dependent membrane targeting

IPR000008 592 600 PR00360 C2 calcium-dependent membrane targeting

IPR001192 612 622 PR00390 Phosphoinositide-specific phospholipase C

HMMPfam IPR015359 1 83 PF09279 EF-hand-like

IPR000909 85 230 PF00388 Phosphatidylinositol-specific phospholipase C

IPR001711 385 499 PF00387 Phosphatidylinositol-specific phospholipase C

IPR000008 519 611 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000909 84 229 SM00148 Phosphatidylinositol-specific phospholipase C

IPR001711 386 499 SM00149 Phosphatidylinositol-specific phospholipase C

IPR000008 518 626 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000909 84 229 PS50007 Phosphatidylinositol-specific phospholipase C

IPR001711 386 498 PS50008 Phosphatidylinositol-specific phospholipase C

IPR000008 504 611 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	95	364	PD001202	Phosphatidylinositol-specific phospholipase C
IPR013841	380	505	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	89	107	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	115	135	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	213	230	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	437	458	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	458	476	PR00390	Phosphoinositide-specific phospholipase C
IPR000008	540	552	PR00360	C2 calcium-dependent membrane targeting
IPR000008	570	583	PR00360	C2 calcium-dependent membrane targeting
IPR000008	592	600	PR00360	C2 calcium-dependent membrane targeting
IPR001192	612	622	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR015359	1	83	PF09279	EF-hand-like
IPR000909	85	230	PF00388	Phosphatidylinositol-specific phospholipase C
IPR001711	385	499	PF00387	Phosphatidylinositol-specific phospholipase C
IPR000008	519	611	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000909	84	229	SM00148	Phosphatidylinositol-specific phospholipase C
IPR001711	386	499	SM00149	Phosphatidylinositol-specific phospholipase C
IPR000008	518	626	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000909	84	229	PS50007	Phosphatidylinositol-specific phospholipase C
IPR001711	386	498	PS50008	Phosphatidylinositol-specific phospholipase C
IPR000008	504	611	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATTACAGACTGCGAACAACG

Primer_r
: ATAGAGTTGCTTGGTTCCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AATTACAGACTGCGAACAACG
Primer_r	: ATAGAGTTGCTTGGTTCCCTG
PCR product length	: 179 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3187 bp
Genome contig ID	gi89161205r_156580365
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATTCATGAAAATATAATTAAAACACATTTTTAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGGTGAACTTTTTTTACAATTGAAATTCATATGATGACTATTGAGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	156680365	156784044	20	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1069

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information