HUGE

Gene/Protein Characteristic Table for KIAA0614

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01104
Accession No. :	AB014514
Description :
HUGO Gene Name :
Clone Name :	hg01176s2 [Vector Info]
Flexi ORF Clone :	pF1KA0614
Source :	Human adult brain
Note :	We replaced hg01176 and hg01176s1, former representative clones for KIAA0614 with hg01176s2. (2002/5/10,2003/8/28)

Features of the cloned DNA sequence	Description

Length: 11211 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2190 bp

Genome contig ID gi89161190r_110982384
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
CTGCCAAGTGGCTAGGAATTAAAGTGTTTCTAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTATGGTCTCTTGGCATTTGACGTGATTCTTACTCCATGAGGTTTTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 111082384 111169738 49 100.0 Terminal No-hit

Features of the protein sequence	Description

Length: 3006 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW97998	100.0	chromosome 12 o...	Homo sapiens
NP_001103132	100.0	chromosome 12 o...	Homo sapiens
XP_001109970	99.4	similar to hect...	Macaca mulatta
XP_001490551	97.7	similar to chro...	Equus caballus
XP_222205	96.9	similar to hect...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037741	1.1e-06	26.9	KIAA1320
D28476	0.00013	25.8	KIAA0045
AB046845	0.0002	23.9	KIAA1625
AB002310	0.00066	22.7	KIAA0312
D13635	0.00094	23.5	KIAA0010

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000569 2681 3004 PF00632 HECT

HMMSmart IPR000569 2635 3000 SM00119 HECT

ProfileScan IPR000569 2647 3006 PS50237 HECT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000569	2681	3004	PF00632	HECT
HMMSmart	IPR000569	2635	3000	SM00119	HECT
ProfileScan	IPR000569	2647	3006	PS50237	HECT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTTGGAGTGTGGATGCTGGTC

Primer_r
: TTACAGGGAGGAGATGGATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAATATCAGAGCCATCCAAGC
Primer_r	: GTAAAGGAAGCTCACTAAAGG
PCR product length	: 140 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2190 bp
Genome contig ID	gi89161190r_110982384
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CTGCCAAGTGGCTAGGAATTAAAGTGTTTCTAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTATGGTCTCTTGGCATTTGACGTGATTCTTACTCCATGAGGTTTTTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	111082384	111169738	49	100.0	Terminal No-hit

Primer_f	: TTTGGAGTGTGGATGCTGGTC
Primer_r	: TTACAGGGAGGAGATGGATGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0614

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information