HUGE

Gene/Protein Characteristic Table for KIAA0782

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00637
Accession No. :	AB018325
Description :	Centaurin-delta 2.
HUGO Gene Name :
Clone Name :	hk05405s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0782
Source :	Human adult brain
Note :	We replaced hk05405, former representative clones for KIAA0782 with hk05405s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4919 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 589 bp

Genome contig ID gi51511727r_71973768
PolyA signal sequence
(TATAAA,-22)
+----*----+----*----+----*----+----
GACTTTTTGATAATATAAATATATCTGTATATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCCTATGGTGCTGAGGCCTGTGATTGGCTAAGGGGATTGGGCGTCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 72073768 72111028 33 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1281 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAT36325	100.0	ARAP1b protein ...	Homo sapiens
XP_508625	99.6	centaurin delta...	Pan troglodytes
XP_001114962	98.0	similar to cent...	Macaca mulatta
EAW74863	98.9	centaurin, delt...	Homo sapiens
BAG09846	100.0	centaurin-delta...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011152	2.5e-68	41.7	KIAA0580
AB040934	6.7e-05	25.7	KIAA1501
D79989	8.2e-05	30.2	KIAA0167
AB051509	0.00013	36.2	KIAA1722
AB014521	0.00031	29.3	KIAA0621

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001164 378 397 PR00405 Arf GTPase activating protein

IPR001164 397 414 PR00405 Arf GTPase activating protein

IPR001164 420 441 PR00405 Arf GTPase activating protein

HMMPfam IPR001849 159 250 PF00169 Pleckstrin-like

IPR001164 366 490 PF01412 Arf GTPase activating protein

IPR001849 575 681 PF00169 Pleckstrin-like

IPR000198 802 951 PF00620 RhoGAP

IPR000159 1003 1092 PF00788 Ras-association

IPR001849 1106 1227 PF00169 Pleckstrin-like

HMMSmart IPR001849 159 252 SM00233 Pleckstrin-like

IPR001849 272 362 SM00233 Pleckstrin-like

IPR001164 366 492 SM00105 Arf GTPase activating protein

IPR001849 575 683 SM00233 Pleckstrin-like

IPR001849 693 787 SM00233 Pleckstrin-like

IPR000198 799 975 SM00324 RhoGAP

IPR001849 1106 1229 SM00233 Pleckstrin-like

ProfileScan IPR001849 158 250 PS50003 Pleckstrin-like

IPR001849 271 360 PS50003 Pleckstrin-like

IPR001164 366 491 PS50115 Arf GTPase activating protein

IPR001849 574 681 PS50003 Pleckstrin-like

IPR000198 785 970 PS50238 RhoGAP

IPR000159 1003 1092 PS50200 Ras-association

IPR001849 1105 1227 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	378	397	PR00405	Arf GTPase activating protein
IPR001164	397	414	PR00405	Arf GTPase activating protein
IPR001164	420	441	PR00405	Arf GTPase activating protein
HMMPfam	IPR001849	159	250	PF00169	Pleckstrin-like
IPR001164	366	490	PF01412	Arf GTPase activating protein
IPR001849	575	681	PF00169	Pleckstrin-like
IPR000198	802	951	PF00620	RhoGAP
IPR000159	1003	1092	PF00788	Ras-association
IPR001849	1106	1227	PF00169	Pleckstrin-like
HMMSmart	IPR001849	159	252	SM00233	Pleckstrin-like
IPR001849	272	362	SM00233	Pleckstrin-like
IPR001164	366	492	SM00105	Arf GTPase activating protein
IPR001849	575	683	SM00233	Pleckstrin-like
IPR001849	693	787	SM00233	Pleckstrin-like
IPR000198	799	975	SM00324	RhoGAP
IPR001849	1106	1229	SM00233	Pleckstrin-like
ProfileScan	IPR001849	158	250	PS50003	Pleckstrin-like
IPR001849	271	360	PS50003	Pleckstrin-like
IPR001164	366	491	PS50115	Arf GTPase activating protein
IPR001849	574	681	PS50003	Pleckstrin-like
IPR000198	785	970	PS50238	RhoGAP
IPR000159	1003	1092	PS50200	Ras-association
IPR001849	1105	1227	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGGAGAGATGGGCATAAGTC

Primer_r
: GCTGTTCTGGAGTTTGTTGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGGAGAGATGGGCATAAGTC
Primer_r	: GCTGTTCTGGAGTTTGTTGGG
PCR product length	: 118 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	589 bp
Genome contig ID	gi51511727r_71973768
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- GACTTTTTGATAATATAAATATATCTGTATATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTATGGTGCTGAGGCCTGTGATTGGCTAAGGGGATTGGGCGTCCTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	72073768	72111028	33	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0782

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information