HUGE

Gene/Protein Characteristic Table for KIAA0809

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06581
Accession No. :	AB018352
Description :	RAD54-like 2.
HUGO Gene Name :	RAD54-like 2 (S. cerevisiae) (RAD54L2)
Clone Name :	hk10195 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk05250, former representative clones for KIAA0809 with hk10195. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4332 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 174 bp

Genome contig ID gi89161205f_51536716
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTGGCAGAGCTCTGTTGCTGTTTAACAAAAGAGGC
Flanking genome sequence
(135936 - 135985)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAGTCCAACACAGCAGCAATAGCGGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 51636716 51672650 20 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1385 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y4B4	100.0	Helicase ARIP4;...	Homo sapiens
EAW65148	99.9	hCG1997495, iso...	Homo sapiens
NP_055921	99.9	RAD54-like 2 [H...	Homo sapiens
XP_001169759	99.8	RAD54-like 2 is...	Pan troglodytes
XP_001096767	98.8	similar to RAD5...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	2.7e-06	23.9	KIAA0309
AB037756	9.9e-06	31.3	KIAA1335
AB037837	1e-05	26.2	KIAA1416
AB046784	1.2e-05	24.0	KIAA1564
AB033085	1.3e-05	24.8	KIAA1259

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000330 192 546 PF00176 SNF2-related

IPR001650 692 772 PF00271 DNA/RNA helicase

HMMSmart IPR014001 185 438 SM00487 DEAD-like helicases

IPR001650 669 772 SM00490 DNA/RNA helicase

ProfileScan IPR014021 210 430 PS51192 Helicase

IPR001650 646 814 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	192	546	PF00176	SNF2-related
IPR001650	692	772	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	185	438	SM00487	DEAD-like helicases
IPR001650	669	772	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	210	430	PS51192	Helicase
IPR001650	646	814	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACTCCCATTCTCACAGCCAC

Primer_r
: GCCTGGATAGATAGACATGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACACGCCAGCCAAAACAGTC
Primer_r	: CTTCTTCAGGCTTGTTGTCAG
PCR product length	: 124 (0.3k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	174 bp
Genome contig ID	gi89161205f_51536716
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGGCAGAGCTCTGTTGCTGTTTAACAAAAGAGGC
Flanking genome sequence (135936 - 135985)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAGTCCAACACAGCAGCAATAGCGGGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	51636716	51672650	20	99.7	Perfect prediction

Primer_f	: CACTCCCATTCTCACAGCCAC
Primer_r	: GCCTGGATAGATAGACATGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0809

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information