HUGE

Gene/Protein Characteristic Table for KIAA0912

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB020719
Description :	Centrosomal protein of 152 kDa.
HUGO Gene Name :	centrosomal protein 152kDa (CEP152)
Clone Name :	hk03560 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4345 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 439 bp

Genome contig ID gi51511731r_46720783
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGTGACAGAGTGAGGCCCTGTCTC
Flanking genome sequence
(99854 - 99805)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGTTTGCAGTGGATAGACCAGAAGCTACAAGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 46820637 46890519 25 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1300 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW77355	100.0	centrosomal pro...	Homo sapiens
XP_523070	91.7	centrosomal pro...	Pan troglodytes
XP_001113236	89.5	similar to myos...	Macaca mulatta
O94986	88.9	Centrosomal pro...	Homo sapiens
XP_001166117	87.6	centrosomal pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046781	1.5e-05	20.3	KIAA1561
AB023217	2.4e-05	21.7	KIAA1000
AB007914	0.00025	21.4	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCCTATTGCTGCTTCCATCC

Primer_r
: CAATCATAGCTTACTGCAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCTATTGCTGCTTCCATCC
Primer_r	: CAATCATAGCTTACTGCAACC
PCR product length	: 209 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	439 bp
Genome contig ID	gi51511731r_46720783
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGTGACAGAGTGAGGCCCTGTCTC
Flanking genome sequence (99854 - 99805)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGTTTGCAGTGGATAGACCAGAAGCTACAAGAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	46820637	46890519	25	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0912

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information