HUGE

Gene/Protein Characteristic Table for KIAA1010

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB023227
Description :	Dynamin-binding protein.
HUGO Gene Name :	dynamin binding protein (DNMBP)
Clone Name :	hj05262 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5403 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1574 bp

Genome contig ID gi89161187r_101525324
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GTAGTTCTTTTATAAATAAAAGCATTTCTAATGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTGGATGTTTTCTTGATTTCCATGTTTAAGCTGAACGGGTTTTTTTGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 101625324 101706436 13 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1315 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6XZF7	100.0	Dynamin-binding...	Homo sapiens
XP_001167601	99.1	dynamin binding...	Pan troglodytes
EAW49850	99.9	dynamin binding...	Homo sapiens
XP_001106775	95.4	similar to dyna...	Macaca mulatta
XP_001500703	83.1	dynamin binding...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037836	2.7e-05	32.1	KIAA1415
AB033082	0.00036	31.4	KIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 1 36 PD000066 Src homology-3

IPR001452 1258 1309 PD000066 Src homology-3

FPrintScan IPR001452 1040 1055 PR00452 Src homology-3

IPR001452 1300 1312 PR00452 Src homology-3

HMMPfam IPR001452 2 38 PF00018 Src homology-3

IPR000219 526 704 PF00621 DH

IPR004148 735 945 PF03114 BAR

IPR011511 1027 1084 PF07653 Variant SH3

IPR001452 1254 1312 PF00018 Src homology-3

HMMSmart IPR001452 1 39 SM00326 Src homology-3

IPR000219 526 704 SM00325 DH

IPR004148 734 948 SM00721 BAR

IPR001452 1026 1085 SM00326 Src homology-3

IPR001452 1254 1313 SM00326 Src homology-3

ProfileScan IPR001452 1 40 PS50002 Src homology-3

IPR000219 522 705 PS50010 DH

IPR004148 746 955 PS51021 BAR

IPR001452 1251 1314 PS50002 Src homology-3

ScanRegExp IPR001331 653 678 PS00741 Guanine-nucleotide dissociation stimulator

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	1	36	PD000066	Src homology-3
IPR001452	1258	1309	PD000066	Src homology-3
FPrintScan	IPR001452	1040	1055	PR00452	Src homology-3
IPR001452	1300	1312	PR00452	Src homology-3
HMMPfam	IPR001452	2	38	PF00018	Src homology-3
IPR000219	526	704	PF00621	DH
IPR004148	735	945	PF03114	BAR
IPR011511	1027	1084	PF07653	Variant SH3
IPR001452	1254	1312	PF00018	Src homology-3
HMMSmart	IPR001452	1	39	SM00326	Src homology-3
IPR000219	526	704	SM00325	DH
IPR004148	734	948	SM00721	BAR
IPR001452	1026	1085	SM00326	Src homology-3
IPR001452	1254	1313	SM00326	Src homology-3
ProfileScan	IPR001452	1	40	PS50002	Src homology-3
IPR000219	522	705	PS50010	DH
IPR004148	746	955	PS51021	BAR
IPR001452	1251	1314	PS50002	Src homology-3
ScanRegExp	IPR001331	653	678	PS00741	Guanine-nucleotide dissociation stimulator

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTCCAAGTGCACATTTAGCC

Primer_r
: CATTACTGCCTTCTGACCACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTCCAAGTGCACATTTAGCC
Primer_r	: CATTACTGCCTTCTGACCACG
PCR product length	: 101 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1574 bp
Genome contig ID	gi89161187r_101525324
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTAGTTCTTTTATAAATAAAAGCATTTCTAATGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTGGATGTTTTCTTGATTTCCATGTTTAAGCTGAACGGGTTTTTTTGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	101625324	101706436	13	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1010

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information