HUGE |
Gene/Protein Characteristic Table for KIAA1079 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00174 |
---|---|
Accession No. : | AB029002 |
Description : | Serine/threonine-protein kinase LMTK2 precursor. |
HUGO Gene Name : | lemur tyrosine kinase 2 (LMTK2) |
Clone Name : | hj06972 [Vector Info] |
Flexi ORF Clone : | pF1KA1079
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4954 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 296 bp Genome contig ID gi89161213f_97474133 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CGGCGTCCCTCAGTGCCCCGTGCACCCGCGGCCGCFlanking genome sequence
(198852 - 198901) ----+----*----+----*----+----*----+----*----+----*
GGCCTCCCAGGCAGTGCTCATGCGCTGGCCGTCGGGGGAGGCAGGGGCAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 97574133 97672983 15 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1476 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAACGAACTCCTTGCCTACAC | |
: TGAGGCTATGCAGGTTGAAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: TTGCCAGCTTTTCCCTCACAC | |
: TCTTCCTCCCAATCTCATGTC | |
: 198 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |