HUGE

Gene/Protein Characteristic Table for KIAA1459

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04903
Accession No. :	AB040892
Description :	Ephrin type-A receptor 8 precursor.
HUGO Gene Name :
Clone Name :	fh16961 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4417 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1853 bp

Genome contig ID gi89161185f_22675592
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTACCCACAATAAGAATAAATTCTGCCTCATCTTT
Flanking genome sequence
(127084 - 127133)
----+----*----+----*----+----*----+----*----+----*
GCCTGCGTCCCCCATTTTTTCCCCATCTCTGAAAGCTTGACATCTCCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 22775592 22802674 15 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 853 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P29322	99.8	Ephrin type-A r...	Homo sapiens
XP_001101560	98.9	similar to EPH ...	Macaca mulatta
XP_595537	96.8	similar to EPH ...	Bos taurus
XP_001501554	96.7	EPH receptor A8...	Equus caballus
EDL29925	95.1	Eph receptor A8...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023216	3.8e-10	28.7	KIAA0999
AB032968	4e-10	26.0	KIAA1142
AB033104	6.3e-10	26.4	KIAA1278
AB018324	7.2e-10	28.7	KIAA0781
AB033090	4.6e-09	29.1	KIAA1264

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001090 1 53 PD001495 Ephrin receptor

IPR000719 490 747 PD000001 Protein kinase

FPrintScan IPR003962 190 199 PR00014 Fibronectin

IPR003962 315 325 PR00014 Fibronectin

IPR003962 338 356 PR00014 Fibronectin

IPR003962 356 370 PR00014 Fibronectin

IPR001245 561 574 PR00109 Tyrosine protein kinase

IPR001245 598 616 PR00109 Tyrosine protein kinase

IPR001245 648 658 PR00109 Tyrosine protein kinase

IPR001245 667 689 PR00109 Tyrosine protein kinase

IPR001245 711 733 PR00109 Tyrosine protein kinase

HMMPfam IPR001090 1 52 PF01404 Ephrin receptor

IPR003961 177 273 PF00041 Fibronectin

IPR003961 285 372 PF00041 Fibronectin

IPR001245 483 740 PF07714 Tyrosine protein kinase

IPR001660 779 840 PF00536 Sterile alpha motif SAM

HMMSmart IPR003961 177 267 SM00060 Fibronectin

IPR003961 288 369 SM00060 Fibronectin

IPR001245 483 740 SM00219 Tyrosine protein kinase

IPR002290 483 744 SM00220 Serine/threonine protein kinase

IPR001660 775 842 SM00454 Sterile alpha motif SAM

ProfileScan IPR003961 176 278 PS50853 Fibronectin

IPR003961 284 379 PS50853 Fibronectin

IPR000719 483 744 PS50011 Protein kinase

IPR001660 782 842 PS50105 Sterile alpha motif SAM

ScanRegExp IPR001426 33 53 PS00790 Receptor tyrosine kinase

IPR001426 95 115 PS00791 Receptor tyrosine kinase

IPR013032 108 121 PS01186 EGF-like region

IPR000719 489 515 PS00107 Protein kinase

IPR008266 604 616 PS00109 Tyrosine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001090	1	53	PD001495	Ephrin receptor
IPR000719	490	747	PD000001	Protein kinase
FPrintScan	IPR003962	190	199	PR00014	Fibronectin
IPR003962	315	325	PR00014	Fibronectin
IPR003962	338	356	PR00014	Fibronectin
IPR003962	356	370	PR00014	Fibronectin
IPR001245	561	574	PR00109	Tyrosine protein kinase
IPR001245	598	616	PR00109	Tyrosine protein kinase
IPR001245	648	658	PR00109	Tyrosine protein kinase
IPR001245	667	689	PR00109	Tyrosine protein kinase
IPR001245	711	733	PR00109	Tyrosine protein kinase
HMMPfam	IPR001090	1	52	PF01404	Ephrin receptor
IPR003961	177	273	PF00041	Fibronectin
IPR003961	285	372	PF00041	Fibronectin
IPR001245	483	740	PF07714	Tyrosine protein kinase
IPR001660	779	840	PF00536	Sterile alpha motif SAM
HMMSmart	IPR003961	177	267	SM00060	Fibronectin
IPR003961	288	369	SM00060	Fibronectin
IPR001245	483	740	SM00219	Tyrosine protein kinase
IPR002290	483	744	SM00220	Serine/threonine protein kinase
IPR001660	775	842	SM00454	Sterile alpha motif SAM
ProfileScan	IPR003961	176	278	PS50853	Fibronectin
IPR003961	284	379	PS50853	Fibronectin
IPR000719	483	744	PS50011	Protein kinase
IPR001660	782	842	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR001426	33	53	PS00790	Receptor tyrosine kinase
IPR001426	95	115	PS00791	Receptor tyrosine kinase
IPR013032	108	121	PS01186	EGF-like region
IPR000719	489	515	PS00107	Protein kinase
IPR008266	604	616	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 28 GFYLAFQDIGACLAILSLRIYY 49 SECONDARY 22

2 390 TIVWICLTLITGLVVLLLLLIC 411 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	28	GFYLAFQDIGACLAILSLRIYY	49	SECONDARY	22
2	390	TIVWICLTLITGLVVLLLLLIC	411	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGGCACCTTCTCTTTTCCAG

Primer_r
: GAGATCCCATGACCTTGTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1853 bp
Genome contig ID	gi89161185f_22675592
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTACCCACAATAAGAATAAATTCTGCCTCATCTTT
Flanking genome sequence (127084 - 127133)	----+--------+--------+--------+--------+----* GCCTGCGTCCCCCATTTTTTCCCCATCTCTGAAAGCTTGACATCTCCTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	22775592	22802674	15	99.4	Perfect prediction

Primer_f	: CAGGCACCTTCTCTTTTCCAG
Primer_r	: GAGATCCCATGACCTTGTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1459

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information