HUGE |
Gene/Protein Characteristic Table for KIAA1084 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07482 |
---|---|
Accession No. : | AB029007 |
Description : | Zinc finger protein 507. |
HUGO Gene Name : | zinc finger protein 507 (ZNF507) |
Clone Name : | hj07515 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5546 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3018 bp Genome contig ID gi42406306f_37428393 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAAAGAATTATACATTGCATAGCACTTAAAAATTTFlanking genome sequence
(114156 - 114205) ----+----*----+----*----+----*----+----*----+----*
GCGGCCGCTTTTCCTTTCTTGTTGCGTTGGTAGCTGACGTTTAGTGGTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 37528393 37542547 4 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 778 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTTGTTGCAGAGTGAGTTTAG | |
: GACAGGTTACAGGGACAAAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: GeneBridge 4 | |
: GTTGTTGCAGAGTGAGTTTAG | |
: GACAGGTTACAGGGACAAAGG | |
: 113 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |