HUGE

Gene/Protein Characteristic Table for KIAA1084

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07482
Accession No. :	AB029007
Description :	Zinc finger protein 507.
HUGO Gene Name :	zinc finger protein 507 (ZNF507)
Clone Name :	hj07515 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5546 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3018 bp

Genome contig ID gi42406306f_37428393
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAAAGAATTATACATTGCATAGCACTTAAAAATTT
Flanking genome sequence
(114156 - 114205)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCTTTTCCTTTCTTGTTGCGTTGGTAGCTGACGTTTAGTGGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 37528393 37542547 4 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 778 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE45937	99.7	hypothetical pr...	Homo sapiens
Q8TCN5	100.0	Zinc finger pro...	Homo sapiens
XP_524202	99.3	hypothetical pr...	Pan troglodytes
BAF85215	99.6	unnamed protein...	Homo sapiens
Q5RDQ6	98.7	Zinc finger pro...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051490	4.9e-06	31.1	KIAA1703
AB040941	1.9e-05	40.5	KIAA1508
AB046835	2.3e-05	34.9	KIAA1615
D87073	2.4e-05	33.3	KIAA0236
AB037817	3e-05	28.7	KIAA1396

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 683 705 PF00096 Zinc finger

IPR007087 711 734 PF00096 Zinc finger

HMMSmart IPR015880 139 161 SM00355 Zinc finger

IPR015880 169 192 SM00355 Zinc finger

IPR015880 262 284 SM00355 Zinc finger

IPR015880 655 677 SM00355 Zinc finger

IPR015880 683 705 SM00355 Zinc finger

IPR015880 711 734 SM00355 Zinc finger

ProfileScan IPR007087 655 682 PS50157 Zinc finger

IPR007087 711 739 PS50157 Zinc finger

ScanRegExp IPR007087 264 284 PS00028 Zinc finger

IPR007087 713 734 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	683	705	PF00096	Zinc finger
IPR007087	711	734	PF00096	Zinc finger
HMMSmart	IPR015880	139	161	SM00355	Zinc finger
IPR015880	169	192	SM00355	Zinc finger
IPR015880	262	284	SM00355	Zinc finger
IPR015880	655	677	SM00355	Zinc finger
IPR015880	683	705	SM00355	Zinc finger
IPR015880	711	734	SM00355	Zinc finger
ProfileScan	IPR007087	655	682	PS50157	Zinc finger
IPR007087	711	739	PS50157	Zinc finger
ScanRegExp	IPR007087	264	284	PS00028	Zinc finger
IPR007087	713	734	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTGTTGCAGAGTGAGTTTAG

Primer_r
: GACAGGTTACAGGGACAAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTTGTTGCAGAGTGAGTTTAG
Primer_r	: GACAGGTTACAGGGACAAAGG
PCR product length	: 113 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3018 bp
Genome contig ID	gi42406306f_37428393
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAAGAATTATACATTGCATAGCACTTAAAAATTT
Flanking genome sequence (114156 - 114205)	----+--------+--------+--------+--------+----* GCGGCCGCTTTTCCTTTCTTGTTGCGTTGGTAGCTGACGTTTAGTGGTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	37528393	37542547	4	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1084

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information