HUGE |
Gene/Protein Characteristic Table for KIAA1171 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00755 |
---|---|
Accession No. : | AB032997 |
Description : | TBC1 domain family member 24. |
HUGO Gene Name : | TBC1 domain family, member 24 (TBC1D24) |
Clone Name : | hh05501s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1171
![]() |
Source : | Human adult brain |
Note : | We replaced hh05501, former representative clones for KIAA1171 with hh05501s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4340 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2527 bp Genome contig ID gi51511732f_2386034 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GGCTGCTCTGCCTATGAAGTAGCCATTCTTTGTTTFlanking genome sequence
(107455 - 107504) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGCCAACATTTGTTGAAACTGCATAATAAATTATCATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 2465155 2493487 8 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 595 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTATGACTGGAATGCTGCAAG | |
: AACCTGCTGGACTTAACTCGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |