HUGE

Gene/Protein Characteristic Table for KIAA1190

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07401
Accession No. :	AB033016
Description :	zinc finger and BTB domain containing 47 (ZBTB47), mRNA.
HUGO Gene Name :	zinc finger and BTB domain containing 47 (ZBTB47)
Clone Name :	hg03443a [Vector Info]
Flexi ORF Clone :	pF1KA1190
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3510 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2983 bp

Genome contig ID gi89161205f_42580291
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GAGGATGAAGGGGAATAAAGTCAGTACAACTCGTG
Flanking genome sequence
(103787 - 103836)
----+----*----+----*----+----*----+----*----+----*
TCCCTTGGCCCAGCCTCTTCTTTGCACTTGGCCTGCCTTGACTCTTGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 42679604 42684076 3 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 174 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UFB7	7.1e-57	100.0	Zinc finger and...	Homo sapiens
BAC86810	1e-56	100.0	unnamed protein...	Homo sapiens
BAG10435	1e-56	100.0	zinc finger and...	synthetic construct
BAE01432	4.5e-55	97.1	unnamed protein...	Macaca fascicularis
XP_851976	3.1e-46	86.2	similar to natu...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023141	2.2e-20	68.0	KIAA0924
AB037760	3.6e-07	39.3	KIAA1339
AB075849	4.9e-07	47.2	KIAA1969
AB075862	5.3e-07	46.2	KIAA1982
D31763	5.6e-07	47.2	KIAA0065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 59 82 PD000003 Zinc finger

HMMPfam IPR007087 3 25 PF00096 Zinc finger

IPR007087 31 53 PF00096 Zinc finger

IPR007087 59 81 PF00096 Zinc finger

IPR007087 87 109 PF00096 Zinc finger

HMMSmart IPR015880 3 25 SM00355 Zinc finger

IPR015880 31 53 SM00355 Zinc finger

IPR015880 59 81 SM00355 Zinc finger

IPR015880 87 114 SM00355 Zinc finger

ProfileScan IPR007087 3 30 PS50157 Zinc finger

IPR007087 31 58 PS50157 Zinc finger

IPR007087 59 86 PS50157 Zinc finger

IPR007087 87 115 PS50157 Zinc finger

ScanRegExp IPR007087 5 25 PS00028 Zinc finger

IPR007087 33 53 PS00028 Zinc finger

IPR007087 61 81 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	59	82	PD000003	Zinc finger
HMMPfam	IPR007087	3	25	PF00096	Zinc finger
IPR007087	31	53	PF00096	Zinc finger
IPR007087	59	81	PF00096	Zinc finger
IPR007087	87	109	PF00096	Zinc finger
HMMSmart	IPR015880	3	25	SM00355	Zinc finger
IPR015880	31	53	SM00355	Zinc finger
IPR015880	59	81	SM00355	Zinc finger
IPR015880	87	114	SM00355	Zinc finger
ProfileScan	IPR007087	3	30	PS50157	Zinc finger
IPR007087	31	58	PS50157	Zinc finger
IPR007087	59	86	PS50157	Zinc finger
IPR007087	87	115	PS50157	Zinc finger
ScanRegExp	IPR007087	5	25	PS00028	Zinc finger
IPR007087	33	53	PS00028	Zinc finger
IPR007087	61	81	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAAGTTGATCTCTCCCAGTGG

Primer_r
: AGGACAGGGTTTCATTGCCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2983 bp
Genome contig ID	gi89161205f_42580291
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAGGATGAAGGGGAATAAAGTCAGTACAACTCGTG
Flanking genome sequence (103787 - 103836)	----+--------+--------+--------+--------+----* TCCCTTGGCCCAGCCTCTTCTTTGCACTTGGCCTGCCTTGACTCTTGGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	42679604	42684076	3	99.0	Perfect prediction

Primer_f	: AAAGTTGATCTCTCCCAGTGG
Primer_r	: AGGACAGGGTTTCATTGCCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1190

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information