HUGE |
Gene/Protein Characteristic Table for KIAA1451 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00230 |
---|---|
Accession No. : | AB040884 |
Description : | Oxysterol-binding protein-related protein 8. |
HUGO Gene Name : | |
Clone Name : | bg00289 [Vector Info] |
Flexi ORF Clone : | pF1KA1451
![]() |
Source : | Human adult brain |
Note : | We replaced fh12482, former representative clones for KIAA1451 with bg00289. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6928 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4107 bp Genome contig ID gi89161190r_75169711 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AATTTTTAAAAAGAGCAAAAAAAAAAAAAAAAAAAFlanking genome sequence
(54430 - 54381) ----+----*----+----*----+----*----+----*----+----*
AAAGACTCAAGTCCTTATCCTACATACTGTGGAAAGTTCAGTGCCTTTCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 75224141 75477391 25 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 939 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TAATCCTATACTTGGCGAGAC | |
: ACTTAGACTTAGCCAGGATAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: CTTCACACATGGACCGTAAAC | |
: TACTAAATGGTGGATGATGGC | |
: 200 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |