HUGE

Gene/Protein Characteristic Table for KIAA0772

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01994
Accession No. :	AB018315
Description :	Oxysterol-binding protein-related protein 2.
HUGO Gene Name :	oxysterol binding protein-like 2 (OSBPL2)
Clone Name :	hk05119 [Vector Info]
Flexi ORF Clone :	pF1KA0772
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3879 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2325 bp

Genome contig ID gi51511747f_60164506
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTAATGTGTGGAAAGTGATGGCCTTCTCGTGGGC
Flanking genome sequence
(140160 - 140209)
----+----*----+----*----+----*----+----*----+----*
CACGCGTTTGGGTGTGAGTATGGCCTTGACCAAGGGTCTTGGTGCTTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 60247030 60304664 14 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAC22307	2.9e-208	100.0	oxysterol bindi...	Homo sapiens
XP_001144165	7.3e-208	99.8	oxysterol-bindi...	Pan troglodytes
Q9H1P3	4.3e-203	97.5	Oxysterol-bindi...	Homo sapiens
XP_001144248	1.1e-202	97.3	oxysterol-bindi...	Pan troglodytes
BAG37950	7e-202	97.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014604	1.5e-39	38.4	KIAA0704
AB051451	4.6e-35	36.9	KIAA1664
AB040884	9e-21	26.9	KIAA1451
AB040967	7.3e-19	28.5	KIAA1534

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000648 24 461 PF01237 Oxysterol-binding protein

ScanRegExp IPR000648 163 173 PS01013 Oxysterol-binding protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000648	24	461	PF01237	Oxysterol-binding protein
ScanRegExp	IPR000648	163	173	PS01013	Oxysterol-binding protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCAGGATTGTGGCGTTATTC

Primer_r
: TCTCACCTCTGGATGTTCTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCAGGATTGTGGCGTTATTC
Primer_r	: TCTCACCTCTGGATGTTCTAG
PCR product length	: 165 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2325 bp
Genome contig ID	gi51511747f_60164506
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAATGTGTGGAAAGTGATGGCCTTCTCGTGGGC
Flanking genome sequence (140160 - 140209)	----+--------+--------+--------+--------+----* CACGCGTTTGGGTGTGAGTATGGCCTTGACCAAGGGTCTTGGTGCTTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	60247030	60304664	14	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0772

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information