HUGE |
Gene/Protein Characteristic Table for KIAA0704 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01603 |
---|---|
Accession No. : | AB014604 |
Description : | Oxysterol-binding protein-related protein 3. |
HUGO Gene Name : | oxysterol binding protein-like 3 (OSBPL3) |
Clone Name : | hg02921s2 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0704 |
Source : | Human adult brain |
Note : | We replaced hg02921, former representative clones for KIAA0704 with hg02921s2. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6137 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3060 bp Genome contig ID gi89161213r_24703267 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AGCCTAAAAAGTAATAAAGTTTTTATTTGGCTGTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GAACCTTGATGTAGCCCCTACTACATACACTACAAGTTATGCCTTCTGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 24803267 24986293 23 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 919 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CTGTTTGGGCATCCTGGGTAC | |
: TGTAGCAGGAGAGCCAGTCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: CTGTTTGGGCATCCTGGGTAC | |
: TGTAGCAGGAGAGCCAGTCAC | |
: 204 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |