HUGE

Gene/Protein Characteristic Table for KIAA1534

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040967
Description :	Oxysterol-binding protein-related protein 5.
HUGO Gene Name :	oxysterol binding protein-like 5 (OSBPL5)
Clone Name :	fh03661 [Vector Info]
Flexi ORF Clone :	pF1KA1534
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4732 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 870 bp

Genome contig ID gi51511727r_2965152
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGGCTGCGAGCTGCAGTCAGCCTTCACGTCTGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTCAGTCCCCGTGTCAGTGCCGCTCTGCGTGTGCGTGTGCGCGTGTGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 3065152 3106878 21 99.3 Terminal No-hit

Features of the protein sequence	Description

Length: 865 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H0X9	99.8	Oxysterol-bindi...	Homo sapiens
EDM12211	84.1	rCG47569, isofo...	Rattus norvegicus
EDM12212	84.1	rCG47569, isofo...	Rattus norvegicus
ACA30310	84.1	oxysterol-bindi...	Mesocricetus au...
Q9ER64	84.1	Oxysterol-bindi...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040884	3.4e-88	55.6	KIAA1451
AB018315	2e-14	28.5	KIAA0772
AB014604	1.9e-12	26.8	KIAA0704
AB051451	1.3e-11	27.4	KIAA1664

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 113 229 PF00169 Pleckstrin-like

IPR000648 324 740 PF01237 Oxysterol-binding protein

HMMSmart IPR001849 113 231 SM00233 Pleckstrin-like

ProfileScan IPR001849 112 229 PS50003 Pleckstrin-like

ScanRegExp IPR000648 460 470 PS01013 Oxysterol-binding protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	113	229	PF00169	Pleckstrin-like
IPR000648	324	740	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	113	231	SM00233	Pleckstrin-like
ProfileScan	IPR001849	112	229	PS50003	Pleckstrin-like
ScanRegExp	IPR000648	460	470	PS01013	Oxysterol-binding protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 843 SPRSWFLLCVFLACQLFINHILK 865 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	843	SPRSWFLLCVFLACQLFINHILK	865	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCCACACAGGAGAAGTTTGC

Primer_r
: GGCCACACAGGAGAAGTTTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGCCACACAGGAGAAGTTTGC
Primer_r	: GGCCACACAGGAGAAGTTTGC
PCR product length	: 141 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	870 bp
Genome contig ID	gi51511727r_2965152
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGGCTGCGAGCTGCAGTCAGCCTTCACGTCTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTCAGTCCCCGTGTCAGTGCCGCTCTGCGTGTGCGTGTGCGCGTGTGTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	3065152	3106878	21	99.3	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1534

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information