HUGE

Gene/Protein Characteristic Table for KIAA1489

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05565
Accession No. :	AB040922
Description :	Kelch repeat and BTB domain-containing protein 2.
HUGO Gene Name :
Clone Name :	fj07905 [Vector Info]
Flexi ORF Clone :	pF1KA1489
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4330 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1175 bp

Genome contig ID gi89161213r_32774308
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACATTAATTTATTAAATAAATTGTATATATTCAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTATTTTTCTTTTGTTATGGGAATGGTCTGCTTTTTAAATTTTGATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 32874308 32878635 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 511 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001108122	100.0	kelch repeat an...	Macaca mulatta
Q8IY47	100.0	Kelch repeat an...	Homo sapiens
XP_001167768	99.8	kelch repeat an...	Pan troglodytes
Q5RDY3	99.6	Kelch repeat an...	Pongo abelii
XP_001167893	99.8	kelch repeat an...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058745	1.5e-31	31.6	KIAA1842
AB037775	4.2e-18	25.0	KIAA1354
AB037730	2.4e-17	24.3	KIAA1309
AB037805	7.6e-16	25.4	KIAA1384
AB067508	1.4e-15	25.6	KIAA1921

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011705 21 122 PF07707 BTB/Kelch-associated

IPR006652 198 255 PF01344 Kelch repeat type 1

IPR006652 257 304 PF01344 Kelch repeat type 1

IPR006652 346 404 PF01344 Kelch repeat type 1

HMMSmart IPR006652 205 268 SM00612 Kelch repeat type 1

IPR006652 269 317 SM00612 Kelch repeat type 1

IPR006652 318 357 SM00612 Kelch repeat type 1

IPR006652 358 420 SM00612 Kelch repeat type 1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011705	21	122	PF07707	BTB/Kelch-associated
IPR006652	198	255	PF01344	Kelch repeat type 1
IPR006652	257	304	PF01344	Kelch repeat type 1
IPR006652	346	404	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	205	268	SM00612	Kelch repeat type 1
IPR006652	269	317	SM00612	Kelch repeat type 1
IPR006652	318	357	SM00612	Kelch repeat type 1
IPR006652	358	420	SM00612	Kelch repeat type 1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 308 QWSAAVVVHDCIYVMTLNLMYC 329 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	308	QWSAAVVVHDCIYVMTLNLMYC	329	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAACCTGTTGTGTGCGTGTG

Primer_r
: ACCTGTGCTCATGTTAGATTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1175 bp
Genome contig ID	gi89161213r_32774308
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACATTAATTTATTAAATAAATTGTATATATTCAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTATTTTTCTTTTGTTATGGGAATGGTCTGCTTTTTAAATTTTGATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	32874308	32878635	1	99.0	Perfect prediction

Primer_f	: TTAACCTGTTGTGTGCGTGTG
Primer_r	: ACCTGTGCTCATGTTAGATTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1489

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information