| HUGE |
Gene/Protein Characteristic Table for KIAA1520 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | |
| Product ID : | ORK01172 |
|---|---|
| Accession No. : | AB040953 |
| Description : | ATP-binding cassette sub-family B member 9 precursor. |
| HUGO Gene Name : | |
| Clone Name : | ah05473 [Vector Info] |
| Flexi ORF Clone : | pF1KA1520
|
| Source : | Human brain (amygdala) |
| Note : | We replaced fh14074, former representative clones for KIAA1520 with ah05473. (2001/2/22) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6051 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 911 bp Genome contig ID gi89161190r_121879500 PolyA signal sequence
(AATAAA,-20)
TGAGAGAACCCGGTCAATAAAGTGTACTACCTCTTFlanking genome sequence
(100000 - 99951)
ACCCCTAACCTCTGACTTCTACTTGGGCCAACTGCCTCATCGCCCAGTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 121979500 122032149 12 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 810 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
