HUGE

Gene/Protein Characteristic Table for KIAA1589

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00873
Accession No. :	AB046809
Description :	Zinc finger FYVE domain-containing protein 1.
HUGO Gene Name :	zinc finger, FYVE domain containing 1 (ZFYVE1)
Clone Name :	fj08951 [Vector Info]
Flexi ORF Clone :	pF1KSDA1589
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4310 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1430 bp

Genome contig ID gi51511730r_72405913
PolyA signal sequence
(CATAAA,-19)
+----*----+----*----+----*----+----
CCATCCAATTCGCCATCATAAAGGAATCTTCCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTCGACTGTGCTGGCTCTTTCCTCTCATTCCATCAGTGCCTTCCAGCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 72505913 72563498 12 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 816 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HBF4	100.0	Zinc finger FYV...	Homo sapiens
XP_522899	99.6	zinc finger, FY...	Pan troglodytes
Q5RFL4	99.5	Zinc finger FYV...	Pongo abelii
XP_547890	96.9	similar to Zinc...	Canis lupus fam...
XP_001488809	97.0	similar to zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040970	6.5e-07	36.1	KIAA1537
AB046863	1.4e-06	38.8	KIAA1643
AB014547	2.9e-06	45.8	KIAA0647
AB002369	5.7e-06	44.1	KIAA0371
AB037783	4.8e-05	27.7	KIAA1362

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000306 632 699 PF01363 Zinc finger

IPR000306 749 815 PF01363 Zinc finger

HMMSmart IPR000306 629 699 SM00064 Zinc finger

IPR000306 746 815 SM00064 Zinc finger

ProfileScan IPR000306 637 698 PS50178 Zinc finger

IPR000306 754 814 PS50178 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000306	632	699	PF01363	Zinc finger
IPR000306	749	815	PF01363	Zinc finger
HMMSmart	IPR000306	629	699	SM00064	Zinc finger
IPR000306	746	815	SM00064	Zinc finger
ProfileScan	IPR000306	637	698	PS50178	Zinc finger
IPR000306	754	814	PS50178	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATCATGGGAAGGAAGGAGTG

Primer_r
: GGAAGCAGATGTTTTGGGCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: CCR
Primer_f	: TTTAGGGAAGTATATGGCGGT
Primer_r	: GGATGGTACACAGTTCTAGAG
PCR product length	: 142 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1430 bp
Genome contig ID	gi51511730r_72405913
PolyA signal sequence (CATAAA,-19)	+--------+--------+----*----+---- CCATCCAATTCGCCATCATAAAGGAATCTTCCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTCGACTGTGCTGGCTCTTTCCTCTCATTCCATCAGTGCCTTCCAGCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	72505913	72563498	12	99.8	Perfect prediction

Primer_f	: AATCATGGGAAGGAAGGAGTG
Primer_r	: GGAAGCAGATGTTTTGGGCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1589

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information